Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Zonation in the ocean?
The oceans play a major role in determining the climate and sustaining life on earth. Oceans help to redistribute the solar energy, through ocean currents and evaporation; they are huge reservoirs of carbon dioxide, oxygen and other minerals and help to regulate the ambient temperature and also help in maintaining atmospheric composition and serve as sources of various natural resources.
The world's seas and oceans are all inter -connected forming a World Ocean. The average depth of the ocean is 3.7 km. In some parts of the world the ocean is 11.5 km deep. Compare this with the height of Mount Everest that is 8848 m above sea level.
What evidence is there that makes it seem humans have more than a material existence?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
- Oogenesis involves the formation of haploid cells from an original diploid cell, called a primary oocyte, through meiosis. - The female ovaries contain the primary oocyte. The
Tetrasporic Embryo Sacs In this group neither of the meiotic divisions is accompanied by wall formation so that at the end of meiosis all the four haploid nuclei remain in a
What is genotype? What is the difference between phenotype and genotype? The Genotype is the genes, DNA nucleotide sequences contained in the chromosomes of an individual, whic
Genetics Genetics is the study of heredity. It is an ancient discipline. At least 4000 years ago, in Sumeria, Egypt and other parts of the world, farmers recognized that they
What sources of water are (a) most likely, (b) least likely to contain pathogenic bacteria? (a) Water most likely to have pathogenic bacteria will be that which receives u
Explain the pH Meter - Food Microbiology? pH is a negative logarithm of H+ ion concentration. Its value remains between 0 and 14. Pure water has a pH of 7 (neutral). pH value l
Vaccinia-like disease Smallpox caused by variola virus (VARV) has successfully been eradicated in the last quarter of the 20th century. However, vaccinia like viruses (VLVs) , viz.
Explain brownian movement When you view a sol through an ultra microscope, you will observe that colloidal particles appear to be in a state of rapid and irregular motion calle
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd