Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Wildlife - Ecology
The term wildlife probably originated in 1913 in a book, Our Vanishing Wildlife by William Hornaday, Director of the New York Zoological Park. The main focus of this book was on the over-exploitation of game birds, mammals and fishes; and also the harvesting of some birds that were not game, notably the song birds that the European immigrants often hunted. By 1937, the term wildlife had been contracted into one word. Though the word wildlife was coined and contracted as one word by the nineteen thirty seven, it was not defined in the well known dictionaries. It was, however, included in the Webster's dictionary in 1986. Webster's dictionary defines wildlife as "living things that are neither human nor domesticated", and the Oxford dictionary says that the wildlife is "the native flora and fauna of a particular region". If we are asked to prepare a list of wildlife species, the list would be dominated by examples of animals, birds and occasionally fishes. Generally, we all think that only large animals, carnivores, game animals and birds constitute the wildlife.
In the present times, the term wildlife encompasses much more than the above mentioned life forms. Now plants, microorganisms and all other lesser known living beings too fall within the purview of wildlife. One essential characteristic feature of wildlife is that they grow and survive in a particular area, without the care of human beings. They are well adapted to the soil, light and temperature conditions of that particular area. All our garden flowers are descendants of the wild flowers. The wild flowers grow on their own in nature, complete their life cycles and grow again the next season.
An impermeable membrane separates a one liter solution of 1M NaCl in the left compartment from a one liter solution of 2M KCl in the right compartment. At 2 AM the membrane became
phylum protozoa
Define Steps for prevention strategies of Obesity? The first and most important step for the rapidly progressing developing countries is to collect and organize data from vario
F ALLOPIAN TUBE - Fertilisation occur in it. 10-12 cm long muscular tube. It is supported by double fold of peritonium. It shows 4 regions - (i ) Infundibulum - Bro
Alfieri Repair: This is advised for ischaenlic mitral regurgitation. In the area of prolapse, the anterior and posterior leaflet edges are approximated with one or two mattress
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
diff b/w protonephridia and metanephridia
Explain Observation or Inference required for osazone test? 1. Crystals of different shapes will be seen. Glucose and fructose give needle shaped crystals and galactose gives f
Advantages of ecological pyramids?
Q. What is cancer? The Cancers are malign neoplasias that is abnormal and uncontrolled proliferation of cells that can disseminate to other sites of the body. The Cancer dissem
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd