Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Wigs and hairs - Seed Appendages
Seeds of certain plants have epidermal outgrowths or the integuments themselves may form folds and projections that present a wing-like appearance. In the tree Oroxylon sp. a thin, transparently white, circular or oval, disc-like wing spreads all around the two-lobed seed. The seed of cucurbit Zanonia macrocarpa has wings measuring up to 10 cm.
In the drumstick plant Moringa oleifera the seed has three equidistant wings. Seed wings provide large surface area, with optimum strength, combined with a minimum of material. A surprisingly large number of winged seeds can be arranged compactly in a fruit. Wings help the seed to propel, sail or spin some distance away when released from the fruit.
What is the structure through which the neural impulse is transmitted from one cell to another? What are its parts? The structure by which the neural impulse passes from one c
Etiology The causes of diarrhoea can be classified as follows: i) Infectious causes Viral : Rota virus, Norwalk and allied viruses, Enterovirus, Influenza virus,
Lateral Roots - Root Apex Lateral roots normally arise at a definite distance behind the tip from areas close to or opposite the points of xylem star. So, a triarch root can
Explain prevention of endocarditis Many physicians believe that antimicrobial prophylaxis before process that may cause transient bacteremia can stop endocarditis and prostheti
State the term - Halsted Reitan varies with the particular test Scoring for the Halsted Reitan varies with the particular test, such that individual scores may be expressed in
Which of the following results from the elimination of the sliding clamp? A. DNA polymerase will no longer be processive and will fall off the double helix after synthesizing
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
A student set up a potometer in the laboratory and measured the rate of movement of water in the capillary. An average of four readings gave a rate of 50mm per minute. The apparatu
Q. Enumerate different implant materials? Biomaterials fall into four categories: metal and metal alloys, ceramics (carbon included in this group) synthetic polymers, and natur
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd