Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Which are the brain regions associated with memory?
According to researchers some of the main regions of the nervous system associated with the memory phenomenon are the hippocampus, located in the interior portion of the temporal lobes, and the frontal lobe cortex, both part of the cerebral hemispheres.
Steps for Prevention Industrial Accidents These steps are as follow: Substitute a less hazardous equivalent. Remove worker from hazard (e.g. automate the sys
Soil Water Soil water relationship is very important. In the fist place the supply of large quantities of water is necessary to satisfy the evapo-transpiration requirements of
What is Coelom - Body Cavity explain? Among the bilaterally symmetrical organisms, animals have three different types of body plans with respect to body cavities. The term coel
Q. How is carbon dioxide made by producers and consumers? The Carbon dioxide is made by consumers and producers through cellular respiration.
VITAMIN - D Also known as Calciferol / Anti ricket vitamin / sun shine vitamin. It is necessary for bones & teeth. It is synthesized in presence of UV rays of sunl
Prevention and control The organism is sensitive to penicillin, tetracycline and other broad-spectrum antibiotics. Newer generation drugs are being used for the treatment of affec
MECHANISM OF GASTRULATION - It is most impotant stage of embryonal development, in which single layered blastula converts into 2 or 3 layered gastrula. During this stage,
Define about the Population Dynamics? In this unit, we are going to study about human population who eventually suffer from these problems. Why do we want to study about human
Define Management and Nutritional Intervention using MNA - Undernutrition? A. For those categorized as well-nourished They need only be reminded of the importance
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd