Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
A plant grown from one of Mendel's yellow pea is selfed. Three progeny peas from this are obtained and they are all green. Is the original plant homozygous or heterozygous, and what would be the probability of obtaining this result?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Why is the plant life cycle known as alternation of generations? The plant life cycle is called as alternation of generations because in this cycle there are two different f
Syngamy The pollen tube grows to a very limited extent in the synergid. It releases the contents either through a terminal or a subterminal pore. The contents include the two
Define the metabolism and respiration of cornea. Metabolism and Respiration of Cornea The cornea requires energy for the maintenance of its transparency. Energy in
Cyclostomes - Regeneration in Vertebrates The larvae of the lampreys between the jawless primitive fishes are able to regenerate their amputated tail. Blastema is made at the
In how many categories nutrients are divided? The nutrients are grouped into three categories: 1) Energy Yielding: Carbohydrates and fats produce energy in the body. 2) B
The destruction of the ozone layer may be responsible for an increase in
How is the genetic determination of sex established in humans? In the diploid genome of human beings there are 46 chromosomes, 44 of them are autosomes and two are sex chromoso
Pyridoxal phoshphate Pyridoxal phosphate is derived from pyridoxine (vitamin B6) and is involved in amino acid metabolism. The other two compounds, pyridoxal and
Q. Why are vaccines made of the own disease agent or of fragments of it? The goal of vaccines is to artificially induce a specific primary immune response (and the consequent f
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd