What would be the probability the result, Biology

Assignment Help:

A plant grown from one of Mendel's yellow pea is selfed. Three progeny peas from this are obtained and they are all green. Is the original plant homozygous or heterozygous, and what would be the probability of obtaining this result?


Related Discussions:- What would be the probability the result

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why plant cycle know as alternation of generations, Q. Why is the plant lif...

Q. Why is the plant life cycle known as alternation of generations? The plant life cycle is called as alternation of generations because in this cycle there are two different f

Syngamy, Syngamy The pollen tube grows to a very limited extent in the...

Syngamy The pollen tube grows to a very limited extent in the synergid. It releases the contents either through a terminal or a subterminal pore. The contents include the two

Define the metabolism and respiration of cornea, Define the metabolism and ...

Define the metabolism and respiration of cornea. Metabolism and Respiration of Cornea The cornea requires energy for the maintenance of its transparency. Energy in

Cyclostomes - regeneration in vertebrates, Cyclostomes - Regeneration in Ve...

Cyclostomes - Regeneration in Vertebrates The larvae of the lampreys between the jawless primitive fishes are able to regenerate their amputated tail. Blastema is made at the

In how many categories nutrients are divided, In how many categories nutrie...

In how many categories nutrients are divided? The nutrients are grouped into three categories: 1) Energy Yielding: Carbohydrates and fats produce energy in the body. 2) B

ZOLOGY, The destruction of the ozone layer may be responsible for an increa...

The destruction of the ozone layer may be responsible for an increase in

How is the genetic determination of sex established in human, How is the ge...

How is the genetic determination of sex established in humans? In the diploid genome of human beings there are 46 chromosomes, 44 of them are autosomes and two are sex chromoso

Explain pyridoxal phoshphate, Pyridoxal phoshphate Pyridoxal  phosphate...

Pyridoxal phoshphate Pyridoxal  phosphate  is  derived  from  pyridoxine  (vitamin  B6)  and  is involved in amino acid metabolism.  The  other  two  compounds,  pyridoxal  and

Why are vaccines made of the own disease agent, Q. Why are vaccines made of...

Q. Why are vaccines made of the own disease agent or of fragments of it? The goal of vaccines is to artificially induce a specific primary immune response (and the consequent f

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd