Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Why Neuron A is a healthy neuron
Neuron A is a healthy neuron with all the usual ion channels. When at rest with a membrane voltage of R millivolts, neuron A produces no action potentials. The voltage threshold for an action potential in neuron A is T millivolts. T is greater than R; T is less than zero. In addition, neuron A's membrane includes the membrane-spanning molecule Z with an ion channel that opens when neurotransmitter Y binds to the Y receptor site on the extracellular surface of Z. The Nernst equilibrium potential for Z's ion channel is E millivolts. Neuron B synapses on neuron A; neuron B's neurotransmitter is neurotransmitter Y. Which of the following statements are true when neuron A is initially at rest and neuron B releases neurotransmitter Y?
A. If the value of E is equal to R, and if chloride is the only ion that passes through open Z channels, then Y's binding to its receptor site on Z in neuron A produces no change in the amount of intracellular chloride ions in neuron A.
B. If the value of E is equal to R, and if chloride is the only ion that passes through open Z channels, then Y's binding to its receptor site on Z in neuron A produces no change in the chloride conductance of the plasma membrane of neuron A.
C. If the value of E is zero and if both sodium ions and potassium ions pass through open Z channels, then Y's binding to its receptor site on Z in neuron A produces no change in the amount of intracellular sodium ions in neuron A.
what is the crystallization of a virus? what is the importance of this process?
The metabolism of phenylalanine will now be taken in some detail, as two inborn errors of metabolism are known which affect this pathway. The Phenylalanine is 1st hydroxylated by p
Cobalt (Co) - Micronutrients The Co concentration in the dry matter of plants grown in soil normally lies around 0.02 to 0.5 ppm. In soils the content varies from 1 to 40 ppm.
Q Which is the kind of nitrogen waste birds produce? Why does this feature, besides being an adaptation to the terrestrial environment, also mean an adaptation to flight? Birds
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what are he characteristic of phylum collenterata?
Define Application of Nutrition Knowledge in Geld of Sports? By the time you are ready to do this unit, you have been exposed to a good deal of the basic knowledge of nutrition
Meninges (Singular-Meninx) - Ceverings of brain. By infection in meninges meningitis or brain fever is caused. These menings are internally lined by squamous epitheliu
Explain Protein Deficiencies in Nutritional Care? A depleted amino acid pool leads to poor wound healing (dehiscence), delayed healing of fractures, anaemia, depressed pulmonar
What is Kingdom Plantae and what organism included in Plantae? Kingdom Plantae : includes organisms that are eukaryotic, multicellular, photosynthetic. Their cells also cont
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd