Why neuron a is a healthy neuron, Biology

Assignment Help:

Why Neuron A is a healthy neuron

Neuron A is a healthy neuron with all the usual ion channels.  When at rest with a membrane voltage of R millivolts, neuron A produces no action potentials.  The voltage threshold for an action potential in neuron A is T millivolts.  T is greater than R; T is less than zero.  In addition, neuron A's membrane includes the membrane-spanning molecule Z with an ion channel that opens when neurotransmitter Y binds to the Y receptor site on the extracellular surface of Z.  The Nernst equilibrium potential for Z's ion channel is E millivolts.  Neuron B synapses on neuron A; neuron B's neurotransmitter is neurotransmitter Y.  Which of the following statements are true when neuron A is initially at rest and neuron B releases neurotransmitter Y?

  A.  If the value of E is equal to R, and if chloride is the only ion that passes through open Z channels, then Y's binding to its receptor site on Z in neuron A produces no change in the amount of intracellular chloride ions in neuron A.

  B.  If the value of E is equal to R, and if chloride is the only ion that passes through open Z channels, then Y's binding to its receptor site on Z in neuron A produces no change in the chloride conductance of the plasma membrane of neuron A.

  C.  If the value of E is zero and if both sodium ions and potassium ions pass through open Z channels, then Y's binding to its receptor site on Z in neuron A produces no change in the amount of intracellular sodium ions in neuron A.

 


Related Discussions:- Why neuron a is a healthy neuron

Viruses, what is the crystallization of a virus? what is the importance of ...

what is the crystallization of a virus? what is the importance of this process?

Metabolism of phenylalanine, The metabolism of phenylalanine will now be ta...

The metabolism of phenylalanine will now be taken in some detail, as two inborn errors of metabolism are known which affect this pathway. The Phenylalanine is 1st hydroxylated by p

Cobalt (co) - micronutrients, Cobalt (Co) - Micronutrients The Co conc...

Cobalt (Co) - Micronutrients The Co concentration in the dry matter of plants grown in soil normally lies around 0.02 to 0.5 ppm. In soils the content varies from 1 to 40 ppm.

Which is the kind of nitrogen waste birds produce, Q Which is the kind of n...

Q Which is the kind of nitrogen waste birds produce? Why does this feature, besides being an adaptation to the terrestrial environment, also mean an adaptation to flight? Birds

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Phylum collenterata, what are he characteristic of phylum collenterata?

what are he characteristic of phylum collenterata?

Define application of nutrition knowledge in geld of sports, Define Applica...

Define Application of Nutrition Knowledge in Geld of Sports? By the time you are ready to do this unit, you have been exposed to a good deal of the basic knowledge of nutrition

Nervous system - meninges, Meninges (Singular-Meninx) - Ceverings of...

Meninges (Singular-Meninx) - Ceverings of brain. By infection in meninges meningitis or brain fever is caused. These menings are internally lined by squamous epitheliu

Explain protein deficiencies in nutritional care, Explain Protein Deficienc...

Explain Protein Deficiencies in Nutritional Care? A depleted amino acid pool leads to poor wound healing (dehiscence), delayed healing of fractures, anaemia, depressed pulmonar

What is kingdom plantae or how organism included in plantae, What is Kingdo...

What is Kingdom Plantae and what organism included in Plantae? Kingdom Plantae :  includes organisms that are eukaryotic, multicellular, photosynthetic. Their cells also cont

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd