Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What respectively are zygotic meiosis, gametic meiosis and sporic meiosis?
Zygotic meiosis is the one that happens in the haplontic haplobiontic life cycle. Gametes from adult haploid individuals unite forming the diploid zygote. The zygote undergoes meiosis and generates four haploid cells that by mitosis develop into adult individuals. Thus in the zygotic meiosis the cell that undergoes meiosis is the zygote and the gametes are produced by mitosis.
Sporic meiosis occurs in metagenesis (alternation of generations, or diplobiontic life cycle). In this life cycle cells from the diploid individual (called sporophyte) undergo meiosis producing haploid spores that do not unite with others but instead develop by mitosis into haploid individuals (known as gametophytes). In this life cycle the gametes are made by mitosis from cells of the gametophyte.
Hepatitis C It provides sustained viral responses (SVRs) of 54% to 63%. When used as monotherapy, peginterferons once weekly are more effective than standard interferon 3 times
Explain about the Musculoskeletal System? Osteopenia (decrease in bone mineral content) is observed with aging. There is an average of 30% decline in the bone mineral density f
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the mode of nutrition in fish,human,amoeba,scorpian & toad ?
Q. Define Eye Balling? Ans. Two-dimensional echocardiography provides a good visual perception of cardiac functions. With experience, the echocardiologist learns to percei
Q. Write the definition of communication? Communication is "a process of transmitting ideas, information, attitudes (images which we have formulated for ourselves) by the use o
Chancroid Chancroid, caused by Haemophilus ducreyi, is rare in the US. A single dose of azithromycin or ceftriaxone is usually effective, but may be less effective in HIV-inf
Q. Symptoms of inflammatory bowel disease? Inflammatory bowel diseases are associated with: • Abdominal cramping, diarrhoea • Steatorrhoea • Obstruction caused due t
HARD Y - WEINBERG LAW - Proposed by G.H. Hardy and W. Weinberg in 1908 independently. The law states "the frequency of genes or alleles in a population remains constant
Define Requirements of Fat in Postoperative Nutritional Care Adequate amount of fat is needed to build up and maintain tissue fat reserves. Depending upon the existing health a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd