What respectively are zygotic meiosis, Biology

Assignment Help:

What respectively are zygotic meiosis, gametic meiosis and sporic meiosis?

Zygotic meiosis is the one that happens in the haplontic haplobiontic life cycle. Gametes from adult haploid individuals unite forming the diploid zygote. The zygote undergoes meiosis and generates four haploid cells that by mitosis develop into adult individuals. Thus in the zygotic meiosis the cell that undergoes meiosis is the zygote and the gametes are produced by mitosis.

Sporic meiosis occurs in metagenesis (alternation of generations, or diplobiontic life cycle). In this life cycle cells from the diploid individual (called sporophyte) undergo meiosis producing haploid spores that do not unite with others but instead develop by mitosis into haploid individuals (known as gametophytes). In this life cycle the gametes are made by mitosis from cells of the gametophyte.

 


Related Discussions:- What respectively are zygotic meiosis

Explain hepatitis c, Hepatitis C It provides sustained viral responses ...

Hepatitis C It provides sustained viral responses (SVRs) of 54% to 63%. When used as monotherapy, peginterferons once weekly are more effective than standard interferon 3 times

Explain about the musculoskeletal system, Explain about the Musculoskeletal...

Explain about the Musculoskeletal System? Osteopenia (decrease in bone mineral content) is observed with aging. There is an average of 30% decline in the bone mineral density f

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Mode of nutrition , What is the mode of nutrition in fish,human,amoeba,scor...

What is the mode of nutrition in fish,human,amoeba,scorpian & toad ?

Define eye balling, Q. Define Eye Balling? Ans. Two-dimensional ec...

Q. Define Eye Balling? Ans. Two-dimensional echocardiography provides a good visual perception of cardiac functions. With experience, the echocardiologist learns to percei

Write the definition of communication, Q. Write the definition of communica...

Q. Write the definition of communication? Communication is "a process of transmitting ideas, information, attitudes (images which we have formulated for ourselves) by the use o

Explain chancroid, Chancroid  Chancroid, caused by Haemophilus ducreyi,...

Chancroid  Chancroid, caused by Haemophilus ducreyi,  is rare in the US. A single dose of azithromycin or ceftriaxone is usually effective, but may be less effective in HIV-inf

Symptoms of inflammatory bowel disease, Q. Symptoms of inflammatory bowel d...

Q. Symptoms of inflammatory bowel disease? Inflammatory bowel diseases are associated with: • Abdominal cramping, diarrhoea • Steatorrhoea • Obstruction caused due t

Hardy - weinberg law, HARD Y - WEINBERG LAW - Proposed by G.H. Hard...

HARD Y - WEINBERG LAW - Proposed by G.H. Hardy and W. Weinberg in 1908 independently. The law states "the frequency of genes or alleles in a population remains constant

Define requirements of fat in postoperative nutritional care, Define Requir...

Define Requirements of Fat in Postoperative Nutritional Care Adequate amount of fat is needed to build up and maintain tissue fat reserves. Depending upon the existing health a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd