Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine by nutritive muscular cell?
The cells which form the gastrodermis lining the inner cavity of cnidarians. They carry out two functions: First is to absorb and digest food and the second is in movement or changing shape by contraction of the myoneme portion of the cell.
What compound composes most of the cell membrane? How is this compound suited to the function of the membrane? Phospholipid composes most of the cell membrane. The hydrophob
The reproductive system of house fly: In houseflies seperate male and female organisms are present. Male housefly reproductive system. The male hothe reproductive syste
Determine the Parts of Stethoscope A stethoscope having of earplugs, binaural pieces, flexible tubing, a stem, and a chest piece. The earplugs are attached to springs made of s
1. A man with normal pigment, whose father was an albino, marries an albino. What chance is there that their first child will be an albino? 2. A man with normal pigment marries
EXCRETIO N IN EARTHWORM - Main organs are nephredia, pharyngeal, integumentary & septed nephredia. Main are septal nephredia situated on septa.Nephrostome present. Body
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Problem of Polarity in Regeneration in Planarians As in Hydra, flatworm regeneration as well appears to occur in a polar fashion. There seems to be ananterior-posterior gradie
green gland is excretory organ of which orthopodic phylem
The Cori cycle a) Pyruvate formed from glucose is converted to lactate by lactate dehydrogenase in the muscle cell. b) Lactate is released into the blood and taken up b
Q. What is an example of a situation in which the neuron cell body is located in a part of the body and its axonal terminal portion is in another distant part of the body? Why does
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd