What is the nitrogen cycle, Biology

Assignment Help:

Q. What is the nitrogen cycle?

The nitrogen cycle represents the recycling and circulation of the chemical element nitrogen in nature. The nitrogen cycle fundamentally depends on the action of various specialized bacteria. The Bacteria of the soil called as nitrogen-fixing bacteria present in plant roots absorb molecular nitrogen from the air and liberate nitrogen in the form of ammonia. The decomposition of organic material as well produces ammonia. In the roots and soil (mainly of leguminous plants), a first group of chemosynthetic bacteria called nitrifying bacteria, the nitrosomonas, produces energy consuming ammonia and releasing nitrite (NO2). The second group of the nitrobacteria, nitrifying bacteria, uses nitrite in chemosynthesis releasing nitrate (NO3). In the form of nitrate, the nitrogen is then incorporated by plants to be used as constituent of nucleic acids and proteins and the element then follows along the food chain. The Nitrogen returns to the atmosphere by the action of denitrifying bacteria that use nitrogen-containing compounds from the soil and release nitrogen gas (molecular nitrogen).


Related Discussions:- What is the nitrogen cycle

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine improper fit at the abutment - implant interface, Improper fit at...

Improper fit at the abutment/- implant interface It is very vital that the fit of the abutment is crosschecked radiographically prior to final delivery of the prosthesis. The m

State the term autopsy data - brain patient, State the term Autopsy data - ...

State the term Autopsy data - Brain patient Autopsy data are not always entirely usable for validation purposes, in that numerous changes may have taken place in the patient's

Explain manifests dominant phenotype, Why can the crossing of an individual...

Why can the crossing of an individual that manifests dominant phenotype with another that manifests recessive phenotype (for the same trait) determine whether the dominant individu

Importance of behaviour change communication, Importance of Behaviour Chang...

Importance of Behaviour Change Communication BCC is an in built part of a diabetes prevention, care and support program. Importance of BCC: · Increase knowledge. BCC can en

Study giude, how many atoms are H2SO4 compound

how many atoms are H2SO4 compound

Rate of transport with increasing solute, Based on the information given in...

Based on the information given in each description, determine if the transporter is likely a channel or a carrier. This transporter shows increasing rate of transport with increasi

Fundamental characters of embryonic development, FUNDAMENTAL CHARACTERS OF ...

FUNDAMENTAL CHARACTERS OF EMBRYONIC DEVELOPMENT 1 .       GAMETOGENESIS- Testes & ovaries are collectively called as gonads. Similarly sperms & ova are collectively calle

Sorbic acid and its salts -preservative, Normal 0 false fa...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

What is parkinsons disease, Q. What is Parkinson's disease? The Parkins...

Q. What is Parkinson's disease? The Parkinson's disease is a degenerative disease of the nervous system in which the major manifestations are progressive motor disturbances, li

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd