Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the nitrogen cycle?
The nitrogen cycle represents the recycling and circulation of the chemical element nitrogen in nature. The nitrogen cycle fundamentally depends on the action of various specialized bacteria. The Bacteria of the soil called as nitrogen-fixing bacteria present in plant roots absorb molecular nitrogen from the air and liberate nitrogen in the form of ammonia. The decomposition of organic material as well produces ammonia. In the roots and soil (mainly of leguminous plants), a first group of chemosynthetic bacteria called nitrifying bacteria, the nitrosomonas, produces energy consuming ammonia and releasing nitrite (NO2). The second group of the nitrobacteria, nitrifying bacteria, uses nitrite in chemosynthesis releasing nitrate (NO3). In the form of nitrate, the nitrogen is then incorporated by plants to be used as constituent of nucleic acids and proteins and the element then follows along the food chain. The Nitrogen returns to the atmosphere by the action of denitrifying bacteria that use nitrogen-containing compounds from the soil and release nitrogen gas (molecular nitrogen).
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Improper fit at the abutment/- implant interface It is very vital that the fit of the abutment is crosschecked radiographically prior to final delivery of the prosthesis. The m
State the term Autopsy data - Brain patient Autopsy data are not always entirely usable for validation purposes, in that numerous changes may have taken place in the patient's
Why can the crossing of an individual that manifests dominant phenotype with another that manifests recessive phenotype (for the same trait) determine whether the dominant individu
Importance of Behaviour Change Communication BCC is an in built part of a diabetes prevention, care and support program. Importance of BCC: · Increase knowledge. BCC can en
how many atoms are H2SO4 compound
Based on the information given in each description, determine if the transporter is likely a channel or a carrier. This transporter shows increasing rate of transport with increasi
FUNDAMENTAL CHARACTERS OF EMBRYONIC DEVELOPMENT 1 . GAMETOGENESIS- Testes & ovaries are collectively called as gonads. Similarly sperms & ova are collectively calle
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Q. What is Parkinson's disease? The Parkinson's disease is a degenerative disease of the nervous system in which the major manifestations are progressive motor disturbances, li
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd