Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the endosymbiotic hypothesis about the origin of mitochondria? And what are the molecular facts that support the hypothesis? And To which other cellular organelles can the hypothesis also be applied?
It is presumed that mitochondria were primitive aerobic prokaryotes that were engulfed in mutualism by primitive anaerobic eukaryotes receiving protection from these beings and offering energy to them. This hypothesis is known as the endosymbiotic hypothesis on the origin of mitochondria.
The hypothesis is strengthened by some molecular evidence such as the fact that mitochondria have their protein synthesis machinery and own independent DNA, with their own ribosomes and RNA, and that they can self- replicate.
The endosymbiotic theory can be applied to chloroplasts too It is supposed that these organelles were primitive photosynthetic prokaryotes because they have their own DNA, ribosomes and RNA and they can self- replicate too.
What is ammensalim? Ammensalism is the ecological interaction in which an individual harms another without obtaining advanatage. Ammensalism is an inharmonious (negative) ecolo
THEOR Y OF GERMPLASM - August Weismann (1834-1914) criticized the inheritance of acquired characters by putting forward the theory of continuity of germplasm. According
#question. what is cloning.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
different types of respiration
It requires the existence of a reliable market for the recovered materials. Although the recovery of certain materials such as aluminium cans large plastic bottles can be profitabl
If you wanted to create a synthetic organelle to test new drugs for toxicity, which natural organelle's function would you try to replicate?
What is Nutrition? Explain types of nutrition? Nutrition - Taking Nutrients from environment Nutrients - Substances which are needed for the sources of chemical potential en
What are some examples of parasitism? Classical instances are the parasites of humans (host), as the trypanosome that causes Chagas' disease, the HIV virus (AIDS), the bacteria
1. Define each term and give an example of an application that uses the following: a. Biocompatible material b. Biodegradable material c. Biomimetic
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd