What is the endosymbiotic hypothesis, Biology

Assignment Help:

Q. What is the endosymbiotic hypothesis about the origin of mitochondria? And what are the molecular facts that support the hypothesis? And To which other cellular organelles can the hypothesis also be applied?

It is presumed that mitochondria were primitive aerobic prokaryotes that were engulfed in mutualism by primitive anaerobic eukaryotes receiving protection from these beings and offering energy to them. This hypothesis is known as the endosymbiotic hypothesis on the origin of mitochondria.

The hypothesis is strengthened by some molecular evidence such as the fact that mitochondria have their protein synthesis machinery and own independent DNA, with their own ribosomes and RNA, and that they can self- replicate.

The endosymbiotic theory can be applied to chloroplasts too It is supposed that these organelles were primitive photosynthetic prokaryotes because they have their own DNA, ribosomes and RNA and they can self- replicate too.


Related Discussions:- What is the endosymbiotic hypothesis

What is ammensalim, What is ammensalim? Ammensalism is the ecological i...

What is ammensalim? Ammensalism is the ecological interaction in which an individual harms another without obtaining advanatage. Ammensalism is an inharmonious (negative) ecolo

Theory of germplasm, THEOR Y OF GERMPLASM - August Weismann (1834-1...

THEOR Y OF GERMPLASM - August Weismann (1834-1914) criticized the inheritance of acquired characters by putting forward the theory of continuity of germplasm. According

Zoology, #question. what is cloning.

#question. what is cloning.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Products that can be recycled, It requires the existence of a reliable mark...

It requires the existence of a reliable market for the recovered materials. Although the recovery of certain materials such as aluminium cans large plastic bottles can be profitabl

Natural organelle''s function would you try to replicate, If you wanted to ...

If you wanted to create a synthetic organelle to test new drugs for toxicity, which natural organelle's function would you try to replicate?

What are Modes of Nutrition, What is Nutrition? Explain types of nutrition?...

What is Nutrition? Explain types of nutrition? Nutrition - Taking Nutrients from environment Nutrients - Substances which are needed for the sources of chemical potential en

What are some examples of parasitism, What are some examples of parasitism?...

What are some examples of parasitism? Classical instances are the parasites of humans (host), as the trypanosome that causes Chagas' disease, the HIV virus (AIDS), the bacteria

Define biocompatible and biodegradable material, 1. Define each term and gi...

1. Define each term and give an example of an application that uses the following: a. Biocompatible material b. Biodegradable material c. Biomimetic

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd