What is self-catalytic rnas, Biology

Assignment Help:

Q. What is self-catalytic RNAs?

Ribozymes -Term 'ribozyme' was initially suggested by Thomas R. Cech, Nobel Prize winning biochemist, who discovered this class of RNA molecules. A ribozyme is an RNA molecule which may catalyze a biochemical reaction. Before discovery of ribozymes, it was generally presumed that protein enzymes were only class of biological catalysts. Cech's discovery was truly revolutionary in upsetting this dogma. First ribozymes discovered were introns which could catalyze their own splicing, that is a special type of intron within a pre-RNA molecule was found to catalyze all steps required for intron removal and joining of exons together at the biologically correct site.

Ribozymes with other kinds of biological activity have since been discovered. One intriguing potential ribozyme is peptidyl transferase activity of ribosome. Many believe that peptide bond formation is catalyzed by23S ribosomal RNA, a potential ribozyme, instead of ribosomal proteins.


Related Discussions:- What is self-catalytic rnas

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Homework, why do ecological models commonly have limited applications?

why do ecological models commonly have limited applications?

What is the significance of elastic capsule chromatophore, What is the sign...

What is the significance of Elastic capsule chromatophore? Specialized pigmented cells on surface of the cephalopods that, by changing their shape, expose differing amounts of

Gases are exchanged when living organisms breathe, Which two gases are exch...

Which two gases are exchanged when living organisms breathe? Oxygen and carbon dioxide are the gases exchanged when living organisms breathe.

Explain the term blood, Explain the term Blood Blood is a fluid and con...

Explain the term Blood Blood is a fluid and consists of plasma and blood cells. More than 90 percent of plasma is water. Other constituents of plasma are plasma proteins i.e. a

Define the ascorbic acid - basic concepts, Define the Ascorbic Acid - Basic...

Define the Ascorbic Acid - Basic Concepts? Ascorbic acid is a water-soluble vitamin, whose structure is shown in Figure. You would have noticed that its structure resembles glu

Define requirements of vitamin a for infants, Define requirements of Vitami...

Define requirements of Vitamin A for infants? As for vitamin A deficiency, requirement of vitamin A is the most easy to meet as it is abundantly present in green and yellow veg

Recycling of plasma membrane components, Recycling of Plasma Membrane Compo...

Recycling of Plasma Membrane Components During exocytosis secretory vesicles fuse with plasma membrane, adding to the membrane surface area. Yet, the surface area of plasma me

Roles of abscisic acid, Roles of Abscisic Acid Abscisic acid (ABA) is ...

Roles of Abscisic Acid Abscisic acid (ABA) is a particularly interesting hormone with regard to the regulation of its own levels. Its levels rise and fall dramatically in seve

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd