What is phagocytosis , Biology

Assignment Help:

Phagocytosis is the ingestion of huge particles like as bacteria and cell debris by large endocytic vesicles called as phagosomes.   In order to be ingested the particle must first bind to the surface of the phagocyte, normally by specialized cell surface receptors. Once it is bound to the receptors, the phagocyte is stimulated   to start   engulfing   the particle   with   its plasma   membrane,   therefore enclosing it within a phagosome given in the figure.  The phagosome then fuses with a lysosome    and the ingested particle is broken down.  The Utilizable material will be elated into the cytosol, although indigestible substances will stay in the lysosomes building residual bodies. In protozoa, phagocytosis is a form of feeding whereas the ingested material is broken down in the lysosomes and utilized as food.

 


Related Discussions:- What is phagocytosis

Coelomoducts in polyplacophora, Coelomoducts in Polyplacophora In Poly...

Coelomoducts in Polyplacophora In Polyplacophora the coelomoducts divide in the region of coelomostome and the gonadal cavities become closed off from pericardial coelom. The

Brasseler endo extractor tube-endodontics principles, Brasseler Endo Extrac...

Brasseler Endo Extractor tube Insert H file buccally and lingually and remove silver by friction.If I can't remove use solvent to desolve cement If the tip of silver not appear

Explain indications of root-end filling (ref) - retrofilling, Explain Indic...

Explain Indications of Root-End Filling (REF) Retrofilling a. Persistent periapical pathosis resulting from an inadequate apical seal that cannot be corrected nonsurgically,

Explain fish actomyosin, Fish actomyosin Fish actomyosin has been found...

Fish actomyosin Fish actomyosin has been found to be quite labile and easily changed during processing and storage. During frozen storage, the actomyosin becomes progressively

What are deciduous trees, What are deciduous trees? The Deciduous trees...

What are deciduous trees? The Deciduous trees are plants that lose their leaves in a period of the year and in the case of the deciduous trees of the temperate forest the fall

Associated foods with escherichia coli, Q. Associated Foods with escherichi...

Q. Associated Foods with escherichia coli? Associated Foods: E. coli is the etiologic agent of food poisoning involves variety of foods such as cream pie, mashed potatoes, cr

Define factors that affect the requirement of protein, Define Factors that ...

Define Factors that affect the requirement of Protein? Protein requirement is greatly influenced by many factors such as age, environmental temperature, energy intake, gender,

Root - plant growth substances, Root - Plant Growth Substances Inducti...

Root - Plant Growth Substances Induction of roots by auxins in stem cuttings is a well known phenomenon. The concentrations needed are much lower as compared to that which pro

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why plant cycle know as alternation of generations, Q. Why is the plant lif...

Q. Why is the plant life cycle known as alternation of generations? The plant life cycle is called as alternation of generations because in this cycle there are two different f

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd