What is cloning, Biology

Assignment Help:

What is cloning?

Cloning is the making of an organism genetically the same to another by means of genetic engineering.

The basis of cloning is the nucleus transplantation machinery. A nucleus from a cell is extracted, usually from an embryonic (not differentiated) cell and this nucleus is inserted into a previously enucleated reproductive cell (in general an egg cell); the egg is then implanted in the organ where the embryonic development will take place. If embryonic development occurs the new organism will have identical genetic patrimony to the organism owner of the cell whose nucleus was used in the transplantation.

 


Related Discussions:- What is cloning

Potassium sparing diuretics, The potassium-sparing agents spironolactone, t...

The potassium-sparing agents spironolactone, triamterene, and amiloride are often useful in combination with the loop diuretics and thiazides. Triamterene and amiloride act on the

How do bacteria reproduce, How do bacteria reproduce? Bacteria replicat...

How do bacteria reproduce? Bacteria replicate by binary fission (scissiparity). Some bacteria though present a kind of sexual reproduction (transformation, transduction or conj

Chemicals of life, give two examples of chemical reactions which are cataly...

give two examples of chemical reactions which are catalysed by enzymes in the course of brewing

Explain endonucleases, Explain Endonucleases Endonucleases  are  nucle...

Explain Endonucleases Endonucleases  are  nucleases present  in  the pancreatic juice like RNAase  andDNAase. These hydrolyze internal phosphodiester bonds which are located m

Regeneration in hydra, Regeneration in Hydra You previously know that...

Regeneration in Hydra You previously know that the Hydra has spectacular regenerative ability. The hydra is a small tubular, two layered fresh water animal computing 20mm in

Effects on materials - air pollutants, Effects on Materials - Air pollutant...

Effects on Materials - Air pollutants Most air pollutants are reactive chemicals, so they react with most of the substances around. You may recall from your chemistry lessons

What are the zymogens, Q. What are the zymogens? proenzymes, or Zymogen...

Q. What are the zymogens? proenzymes, or Zymogens, are enzymes secreted in inactive form. Under some conditions a zymogen shifts to the active form of the enzyme. Zymogen secre

Branches of embryology, BRANCHES OF EMBRYOLOGY- 1 .       DESCRIPTIVE...

BRANCHES OF EMBRYOLOGY- 1 .       DESCRIPTIVE EMBRYOLOGY This field of embryology is associated with the morphological description of different embryonic stages in the on

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Locate the position of the submerged implants, Locate the position of the s...

Locate the position of the submerged implants. It can be located by the following means: - correlating the radiographs with intraoral position - on slight palpation of  soft

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd