What is cellulose, Biology

Assignment Help:

What is cellulose?

Cellulose is a long-chain polymeric polysaccharide carbohydrate, of beta-glucose. It creates the primary structural component of green plants. The primary cell wall of green plants is made primarily of cellulose; the secondary wall having cellulose with variable amounts of lignin. Lignin and cellulose, considered together, are termed lingo cellulose, which (as wood) is argued to be single of the most common biopolymers on Earth (chrysolaminarin is often argued to be the other). Only single group of animals, the tunicates, has the ability to make and use cellulose.

 


Related Discussions:- What is cellulose

Enumerate different implant materials, Q. Enumerate different implant mater...

Q. Enumerate different implant materials? Biomaterials fall into four categories: metal and metal alloys, ceramics (carbon included in this group) synthetic polymers, and natur

Experiment, I need an idea for a Biology experiment

I need an idea for a Biology experiment

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the steps for conversion of food, Steps for Conversion of food ...

Steps for Conversion of food Conversion of food is done in four steps: 1) Ingestion, mastication and swallowing: Ingestion or taking in of food and mastication are done b

Botany, tell me best topic related to botany

tell me best topic related to botany

Procedures for diagnosis - immune responses and biomarkers, Demonstration o...

Demonstration of immune responses and biomarkers: This may be done either on the basis of sero-conversion study on paired sera samples or by challenge (protection) test.

Respiration, difference between anaerobic respiration and fermentation

difference between anaerobic respiration and fermentation

Discuss about brain, Brain Brain is a part of central nervous system wh...

Brain Brain is a part of central nervous system which lies in the skull. Source: Sears and Windwood, Anatomy and Physiology for Nurses The different parts of the bra

Digestive system, which enzymes are required for digestion in cockroach?

which enzymes are required for digestion in cockroach?

Valve thrombosis-complications of prosthetic valves, Valve Thrombosis :  ...

Valve Thrombosis :  Valve thrombosis causes sudden deterioration of the patient's haemodyarnics. A stuck valve may produce both stenosis and incompetence. If diagnosed early s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd