Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is cellulose?
Cellulose is a long-chain polymeric polysaccharide carbohydrate, of beta-glucose. It creates the primary structural component of green plants. The primary cell wall of green plants is made primarily of cellulose; the secondary wall having cellulose with variable amounts of lignin. Lignin and cellulose, considered together, are termed lingo cellulose, which (as wood) is argued to be single of the most common biopolymers on Earth (chrysolaminarin is often argued to be the other). Only single group of animals, the tunicates, has the ability to make and use cellulose.
Q. Enumerate different implant materials? Biomaterials fall into four categories: metal and metal alloys, ceramics (carbon included in this group) synthetic polymers, and natur
I need an idea for a Biology experiment
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Steps for Conversion of food Conversion of food is done in four steps: 1) Ingestion, mastication and swallowing: Ingestion or taking in of food and mastication are done b
tell me best topic related to botany
Demonstration of immune responses and biomarkers: This may be done either on the basis of sero-conversion study on paired sera samples or by challenge (protection) test.
difference between anaerobic respiration and fermentation
Brain Brain is a part of central nervous system which lies in the skull. Source: Sears and Windwood, Anatomy and Physiology for Nurses The different parts of the bra
which enzymes are required for digestion in cockroach?
Valve Thrombosis : Valve thrombosis causes sudden deterioration of the patient's haemodyarnics. A stuck valve may produce both stenosis and incompetence. If diagnosed early s
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd