Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is cytosolic cyclic AMP
Healthy Person P takes a new drug that is a member of a drug family that results in constant levels of cytosolic cyclic AMP (cAMP) in one and only one cell type in the body. A single dose of each member of the new drug family works within one hour and lasts for one week. Which of the following is true for P one day after taking a specific member of the new drug family?
A. Consider the situation that P takes Drug A that produces constant very low levels of cytosolic cAMP in the epithelial cells of the medullary collecting duct of the kidney. One day after taking Drug A, the water permeability of the luminal membranes of these cells in P will be higher than pre-drug levels.
B. Consider the situation that P takes Drug B that produces constant very low levels of cytosolic cAMP in the SA node cells of the heart. One day after taking Drug B, P's heart rate will be higher than pre-drug levels.
C. Consider the situation that P takes Drug C that produces constant very high levels of cytosolic cAMP in the cells of the liver. Ignore any effects due to insulin binding to insulin receptors in the liver. One day after taking Drug C, the amount of glycogen in P's liver cells will be higher than pre-drug levels.
What is Punnett Squares in genetics? The probability, or likelihood, that a certain phenotypic or genotypic trait will appear in offspring can be predicted and diagrammed using
Explain disease typhoid Typhoid is often called enteric fever because the infection or bacteria is found in the intestines and attaches itself to the epithelium of the intes
Explain Glycerol esters of fatty acids Glycerol esters of fatty acids, which make up to 99% of the lipids of plant and animal origin have been traditionally called fats and oi
Explain the Disadvantages of Colonies Obtained At Different Dilution 1. Heat sensitive microorganisms may be damaged by melted agar, giving low viable count as compared to spre
what is respiration?
Suggest a mechanism that would allow a plant to grow better if it had intermorph neighbors than if it had intramorph neighbors. Think about the degree of genetic similarity between
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Obesity - Problems of Older Children and Adolescent Nutrition? One of the major problems is raising obesity rates (upto 30%) in urban, well-to-do school children.Th
Define Triple Sugar iron - Carbohydrate Utilization Pattern? Triple sugar iron (TSI) agar is used to observe carbohydrate utilization pattern. The medium contains 1% concentr
Which level of a gene, such as the ADH gene and its encoded product should have the highest homology among different species? Explain your answer. A. The genomic DNA sequences o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd