What factor contributed to the current variations, Biology

Assignment Help:

According to the theory of natural selection, what factor below contributed to the current variations in beak sizes of finch species on the Galapagos Islands? a. Finches dispersed to islands where their beak sizes closely matched available seed sizes b. Different finch populations needed to change in order to survive, so beneficial new traits arose c. Non-heritable variation between individual was important for natural selection to work d. Genetic drift allowed beneficial traits to spread throughout the population e. Seeds are limited resource.


Related Discussions:- What factor contributed to the current variations

Techniques of plant tissue culture, Techniques of Plant Tissue Culture ...

Techniques of Plant Tissue Culture A standard tissue culture laboratory should provide facilities for washing and storage of glass ware, preparation and storage of nutrient

Are the arteries constituted of more muscle tissue, Q. Are the veins or the...

Q. Are the veins or the arteries constituted of more muscle tissue? How different are the walls of these two kinds of blood vessels? The arterial system has thicker muscle wall

Phosphorylation of fructose-6-phosphate, Phosphorylation  of  fructose-6-...

Phosphorylation  of  fructose-6-phosphate Phosphorylation  of  fructose-6-phosphate: This  is  an irreversible reaction, catalyzed byphosphofructo72Snase,  (PFK-  I) a rate-l

On which organs glucagon and insulin act, Q. What are the target organs up...

Q. What are the target organs upon which glucagon and insulin act? Glucagon mainly acts upon the liver and Insulin acts generally upon all cells. Both also act upon the adipose

What is the futile cycle, What is the futile cycle The futile cycle is ...

What is the futile cycle The futile cycle is avoided because covalent modification, by  phosphorylation, has opposite effects on  the  enzymes concerned with  the  synthesis  a

Explain the sponge method, Explain the Sponge Method? In the sponge met...

Explain the Sponge Method? In the sponge method, sterilized sponge with 45 x 5 cm contact surface and free from antimicrobial agent is used. Aseptically, it is moistened with 1

Nucleus of a spermatogonia, Plot the amount of DNA in the nucleus of a sper...

Plot the amount of DNA in the nucleus of a spermatogonia from the G1 stage prior to the first meiotic division through the completion of meiosis. Label each of the major stages of

Precaution - separation of amino acid by paper chromatogrphy, Define Precau...

Define Precaution for Separation of Amino Acids by Paper Chromatography? 1. Hold the paper with the extra strip kept at one side. Handling of whatman paper with hand should be

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd