Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
According to the theory of natural selection, what factor below contributed to the current variations in beak sizes of finch species on the Galapagos Islands? a. Finches dispersed to islands where their beak sizes closely matched available seed sizes b. Different finch populations needed to change in order to survive, so beneficial new traits arose c. Non-heritable variation between individual was important for natural selection to work d. Genetic drift allowed beneficial traits to spread throughout the population e. Seeds are limited resource.
Techniques of Plant Tissue Culture A standard tissue culture laboratory should provide facilities for washing and storage of glass ware, preparation and storage of nutrient
Q. Are the veins or the arteries constituted of more muscle tissue? How different are the walls of these two kinds of blood vessels? The arterial system has thicker muscle wall
Phosphorylation of fructose-6-phosphate Phosphorylation of fructose-6-phosphate: This is an irreversible reaction, catalyzed byphosphofructo72Snase, (PFK- I) a rate-l
Q. What are the target organs upon which glucagon and insulin act? Glucagon mainly acts upon the liver and Insulin acts generally upon all cells. Both also act upon the adipose
What is the futile cycle The futile cycle is avoided because covalent modification, by phosphorylation, has opposite effects on the enzymes concerned with the synthesis a
Explain the Sponge Method? In the sponge method, sterilized sponge with 45 x 5 cm contact surface and free from antimicrobial agent is used. Aseptically, it is moistened with 1
Plot the amount of DNA in the nucleus of a spermatogonia from the G1 stage prior to the first meiotic division through the completion of meiosis. Label each of the major stages of
Define Precaution for Separation of Amino Acids by Paper Chromatography? 1. Hold the paper with the extra strip kept at one side. Handling of whatman paper with hand should be
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is succession?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd