Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are the problems that vertebrates required to solve to adapt to the terrestrial environment as they came from the aquatic habitat? How evolution does solve those problems?
The main problems vertebrates coming from water needed to solve to adapt to the terrestrial environment were the following: the difficulty to avoid dehydration; the problem of elimination of wastes in a medium where water is fewer available; the problem of protection against nocent solar radiation; the problem of gamete locomotion in the environment for fecundation; the problem of gas exchange, earlier completed by direct contact of water with gills; the problem of body support, as it was water that played this role in fishes.
Prevention and control The organism is sensitive to penicillin, tetracycline and other broad-spectrum antibiotics. Newer generation drugs are being used for the treatment of affec
What are the advancement of cnidaria over protozoa
Equine infectious anaemia Equine infectious anemia (EIA), an acute or chronic viral disease of the equines, shows intermittent fever, loss of weight, depression, progressive w
Which functional group (side-chain) can be "cross-linked" in protein? a. sulfhydryl b. amino c. Phosphate d. Hydroxyl e. Carboxyl
Biota of Pelagic Zone Pelagic region constitutes 90 per cent of the total ocean surface and is less rich in species and numbers of organisms than the two regions discussed bef
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Thermoregulation in Cold? Heat production parallels the increase in O 2 uptake, the magnitude of which depends on the muscle mass .engaged in slivering or work and the
What are the Biotolerant materials Biotolerant materials, are characterized by a thin fibrous tissue interface. The fibrous tissue layer develops as a result of the chemical pr
Importance of vitamin D Vitamin D is mainly involved in the calcium and phosphate metabolism. It usually promotes absorption of calcium and inorganic phosphate from the intest
Which is the typical feature of the hookworms related to the way they obtain food and explore the host? Both Ancylostoma duodenale and Necator americanus have mouthparts with h
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd