What are the problems that vertebrates required, Biology

Assignment Help:

What are the problems that vertebrates required to solve to adapt to the terrestrial environment as they came from the aquatic habitat? How evolution does solve those problems?

The main problems vertebrates coming from water needed to solve to adapt to the terrestrial environment were the following: the difficulty to avoid dehydration; the problem of elimination of wastes in a medium where water is fewer available; the problem of protection against nocent solar radiation; the problem of gamete locomotion in the environment for fecundation; the problem of gas exchange, earlier completed by direct contact of water with gills; the problem of body support, as it was water that played this role in fishes.

 


Related Discussions:- What are the problems that vertebrates required

Chlamydiosis-prevention and control, Prevention and control The organism i...

Prevention and control The organism is sensitive to penicillin, tetracycline and other broad-spectrum antibiotics. Newer generation drugs are being used for the treatment of affec

Cnidaria and protozoan, What are the advancement of cnidaria over protozoa

What are the advancement of cnidaria over protozoa

Horse diseases-equine infectious anaemia, Equine infectious anaemia Eq...

Equine infectious anaemia Equine infectious anemia (EIA), an acute or chronic viral disease of the equines, shows intermittent fever, loss of weight, depression, progressive w

Which functional group cross-linked in protein, Which functional group (sid...

Which functional group (side-chain) can be "cross-linked" in protein? a. sulfhydryl b. amino c. Phosphate d. Hydroxyl e. Carboxyl

Biota of pelagic zone, Biota of Pelagic Zone Pelagic region constitute...

Biota of Pelagic Zone Pelagic region constitutes 90 per cent of the total ocean surface and is less rich in species and numbers of organisms than the two regions discussed bef

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is thermoregulation in cold, What is Thermoregulation in Cold? Hea...

What is Thermoregulation in Cold? Heat production parallels the increase in O 2 uptake, the magnitude of which depends on the muscle mass .engaged in slivering or work and the

What are the biotolerant materials, What are the Biotolerant materials ...

What are the Biotolerant materials Biotolerant materials, are characterized by a thin fibrous tissue interface. The fibrous tissue layer develops as a result of the chemical pr

What is the importance of vitamin D, Importance of vitamin D Vitamin D ...

Importance of vitamin D Vitamin D is mainly involved in the  calcium and phosphate metabolism. It usually promotes absorption of calcium and inorganic phosphate from the intest

Which is the typical feature of the hookworms, Which is the typical feature...

Which is the typical feature of the hookworms related to the way they obtain food and explore the host? Both Ancylostoma duodenale and Necator americanus have mouthparts with h

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd