Walrasian model, Biology

Assignment Help:

Walrasian Model

The basic assumptions of a Walrasian model necessary to establish the desired equilibrium under the mechanisms of competitive market conditions are:

(i) The goods involved behave like true private goods i.e. they are governed by the features of excludability, rivalry and rejectability;

(ii) Rights are perfectly delineated; and

(iii) The transaction costs are minimum.

The application of these assumptions to the services of healthcare sector reveal that while the first of the three assumptions is met by most healthcare goods and services (at least to some degree), the remaining two are generally not met. Further, since our focus is on the production characteristics, it is necessary to understand the optimal organisational arrangements for service production.

The developments relevant to understanding the different arrangements for service delivery derive from four theories of organisation viz.

(i) Principal-agent theory;

(ii) Transaction costs economics theory;

(iii) Property rights theory;

(iv) Public choice theory.

The agency literature surveys the range of contracts observed in the economy with respect to incentives and cooperation. Generalising from a full range of relationships (from employment contracts to the various other more complex relationships that make up the firm), the theory points out to the need for effective incentive alignment. The relationship between patient and physician or governments and contracting agencies are cited as classic examples of the principal-agent structure. On the other hand, pointing out that both the principal and the agent are opportunists seeking to minimise production/transaction costs and maximise their benefits, the transaction costs economics theory emphasises the need for  flexible means of coordinating activities. This theory advocates vertically integrated (i.e. unified ownership) organisational structures with features of simple spot contracts, franchises or joint ventures. Claiming that such arrangements provide discrete structural alternatives, the theory holds that governance arrangements can be evaluated by comparing the patterns of costs incurred in production and exchange.

Pooling of risks and rewards for various activities undertaken, facilitating the sharing of information, pursuit of innovation, and promoting a culture of cooperation are considered the positive features of the transaction cost theory. The theory however, it is argued, suffers from characteristic weaknesses like the ‘proliferation of influence activities’. This is illustrated by the presence of provider organisations in the healthcare sector who try to gain advantage by influencing decisions on the distribution of resources (or other benefits) among the providers. Evidence of such activities is cited in the tendency to allocate resources to tertiary and curative care at the expense of primary, preventive and public health activities. The property rights theory attempts to find out why private ownership has strong positive incentives for efficiency. It identifies the prevalence of this feature to the scope for ‘residual rights of control’ which refers to the rights of owners on the revenue remains of the total proceeds once the expenses and the contractual obligations have been met out. The public or the political choice theory focuses on the self-interested behaviour of influential segments (e.g. politicians, bureaucrats, and other interested groups). The theory points out that owing to the capturing of increasing portions of resources by powerful interest groups, institutional rigidities develop impacting adversely on the economic growth.


Related Discussions:- Walrasian model

Illustrate about sterilization protocol, Q. Illustrate about Sterilization ...

Q. Illustrate about Sterilization protocol? Sterilization protocol includes proper transportation and cleaning of instruments followed by their packing. Items can be sterilized

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Sausage classification - meat products, S a u s a g e classification ...

S a u s a g e classification Classification                                      Examples Cooked-smoked                               Frankfurters, Bologna, Mortadel

Aeration, Aeration is the process on which water and air come into contact....

Aeration is the process on which water and air come into contact. It is carried out by spraying water in the form of spray or fountain over air. Aeration achieves the following obj

Nature of disease, Q. Nature of disease? Education is very important fo...

Q. Nature of disease? Education is very important for diabetics because it is a lifelong disorder. In order to enable the patient to lead a healthy and a good quality Life free

State the medial pterygoid, Medial pterygoid Muscle bounds the pterygom...

Medial pterygoid Muscle bounds the pterygomandibular space medially which is entered when an inferior alveolar nerve block is administered. Infection of this space is dangerous

Explain the localized aggressive periodontitis, Explain the Localized Aggre...

Explain the Localized Aggressive Periodontitis Localized Aggressive Periodontitis: It has been in literature that transmission of peridontopathic microorganisms from periodon

Describe class echinoidea in animal kingdom, Describe Class Echinoidea in a...

Describe Class Echinoidea in animal kingdom? Sand dollars and sea urchins either have flattened disc-like bodies, or are somewhat spherical. While they lack the typical five-ar

Describe how the international astronomical union defines, Describe how the...

Describe how the International Astronomical Union defines a planet. Also include why Pluto is no longer considered a planet.

Explain about the alzheimer''s disease, Explain about the Alzheimer's Disea...

Explain about the Alzheimer's Disease? Named after the German neurologist who first described it, Alzheimer's disease is the most common cause of progressive dementia, due to t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd