Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. The vascular lesions caused by leeches upon the blood vessels of their host cause blood naturally to coagulate. How does the leech solve this problem since it could be expected that the ingested blood would coagulate inside its body?
Ingested blood does not coagulate inside the leech (Hirudo medicinalis) because in its saliva there is a potent anticoagulant substance a protein that is called as hirudin.
In the past leeches were largely used as medical treatment. Nowadays hirudotherapy is being used in patients with chronic inflammation of the skin and extensive in prevention against tissue necrosis after some surgeries and in several others fields of Medicine.
What are the typical vegetation and the typical fauna of the tropical forests? In the vegetation of the tropical forests broadleaf evergreen trees predominate. On the top of th
Neural process occurring in the recovery from brain injury The neural process occurring in the recovery from brain injury are thought to be similar to the processes involved in
What are plant root hairs? Where can they found and what is their function? The Root hairs that are external elongated projections of the root epidermis and their role is to in
Explain brifly Ribosomes, Endoplasmic Reticulum, Golgi Apparatus ? Ribosomes, Endoplasmic Reticulum, Golgi Apparatus : The cytoplasm contains many ribosomes, which are sphe
Define about Traumatic needles Traumatic needles are needles with holes or eyes which are supplied to the hospital separate from their suture thread. The suture must be thread
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Two true-breeding pea plants were crossed. One parent is round, terminal, and violet, constricted, while the other expresses the respective contrasting phenotypes of wrinkled, axia
To get the idea on the process capability that whether the intended process provides the consistent results or not(precision).
Types of individuals in Cnidaria There are two forms of individuals in Cnidaria: Polyp Medusa Polyp is tubular, the oral end being free carrying
A friend of yours suggests that the origin of life on earth is extraterrestrial in origin (an idea known as panspermia). Can you propose a testable hypothesis to determine if this
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd