Types of parthenogenesis, Biology

Assignment Help:

TYPES OF PARTHENOGENESIS -

1.      NATURAL PARTHENOGENESIS -

In many animals natural parthenogenesis is common process & is a method of reproduction.

It is of two types -

(i) Arrhenotoky or haploid parthenogenesis -

  1. In this parthenogenesis the haploid egg develops parthenogenetically to form haploid parthenote.
  2. eg. Honey bees, Ants, Gall fly, Wasp & Arachnida.
  3. In honey bees haploid egg parthenogenetically developed to form male & the fertilize diploid egg forms female.

(ii) Thelytoky or Diploid parthenogenesis -

  1. In this diploid eggs developed parthenogenetically to form diploid parthenote.
  2. Diploid generation is always female.
  3. In this meiosis not take place during gametogenesis.
  4. eg. Aphids, Daphnia, Nematods, Rotifers, Trematodes etc.

2.       ARTIFICIAL PARTHENOGENESIS -

  1. Artificial parthenogenesis can be induced by shaking, puncture, chemicals (KCl, CO , weak acid, weak base), changes in temperature & changes in osmotic pressure.
  2. Loeb studied in frog parthenogenetically ova to sexual maturity.
  3. In Lacerta Sexicola lizard eggs are diploid and develop into female. The male are absent.

1766_types of parthenogenesis.png


Related Discussions:- Types of parthenogenesis

Ventilation of tracheal system, Ventilation of Tracheal System The man...

Ventilation of Tracheal System The manner in which tracheae are ventilated varies with species of insects but movement of air is achieved in two ways: Diffusion

Describe briefly about vitamin B2, Vitamin B 2 (Riboflavin) Riboflavin...

Vitamin B 2 (Riboflavin) Riboflavin is a yellow to orange-yellow, crystalline powder of faint odour and intensely bitter taste. Its solubility in water is very slight and depe

Purposes of patient /client records, PURPOSES OF PATIENT's /CLIENT's RECO...

PURPOSES OF PATIENT's /CLIENT's RECORDS Following purposes are served by maintaining patient's/client's records: A means of communication.  A basis on which therap

Determine health hazards associated with high altitude, Determine Health Ha...

Determine Health Hazards Associated with High Altitude? Abrupt exposure to altitudes greater than 10,000 ft (3050 in) elevation is frequently associated with symptoins of altit

Explain counseling children, Counseling children Assess the child's sta...

Counseling children Assess the child's stage of development. Adjust counseling for a child's  dependency needs,  lack of  experience and  the development tasks faced by  him

Advantages and disadvantages of measurement of cell mass, Define Advantages...

Define Advantages and Disadvantages of Measurement of Cell Mass? Advantage 1. It is a useful technique for estimating fungal and actinomycetes growth. Disadvantages 1.

How is energy transferred along a food chain?, How is energy transferred al...

How is energy transferred along a food chain? The energy flux beside a food chain is always unidirectional, from the producers to the decomposers.

Epithelial Cells, What are all teh parts of a simple ciliated columnar epit...

What are all teh parts of a simple ciliated columnar epithilial cell?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Zoogly, are protozoans primitive to life .

are protozoans primitive to life .

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd