Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
TYPES OF PARTHENOGENESIS -
1. NATURAL PARTHENOGENESIS -
In many animals natural parthenogenesis is common process & is a method of reproduction.
It is of two types -
(i) Arrhenotoky or haploid parthenogenesis -
(ii) Thelytoky or Diploid parthenogenesis -
2. ARTIFICIAL PARTHENOGENESIS -
Ventilation of Tracheal System The manner in which tracheae are ventilated varies with species of insects but movement of air is achieved in two ways: Diffusion
Vitamin B 2 (Riboflavin) Riboflavin is a yellow to orange-yellow, crystalline powder of faint odour and intensely bitter taste. Its solubility in water is very slight and depe
PURPOSES OF PATIENT's /CLIENT's RECORDS Following purposes are served by maintaining patient's/client's records: A means of communication. A basis on which therap
Determine Health Hazards Associated with High Altitude? Abrupt exposure to altitudes greater than 10,000 ft (3050 in) elevation is frequently associated with symptoins of altit
Counseling children Assess the child's stage of development. Adjust counseling for a child's dependency needs, lack of experience and the development tasks faced by him
Define Advantages and Disadvantages of Measurement of Cell Mass? Advantage 1. It is a useful technique for estimating fungal and actinomycetes growth. Disadvantages 1.
How is energy transferred along a food chain? The energy flux beside a food chain is always unidirectional, from the producers to the decomposers.
What are all teh parts of a simple ciliated columnar epithilial cell?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
are protozoans primitive to life .
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd