Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
what is radula?
Action of Hormones We said earlier that hormones are released into the blood stream or extracellular fluid and therefore, reach most of the cells of the body. However, they
Methods to Overcome Incompatibility It has been possible to facilitate the germination of incompatible pollen by extracting pollen wall proteins from compatible pollen and su
State the terms complete alimentary tract, complete digestive tract and complete gut? A digestive tract which has an anal and oral opening. This adaptation allowed for a linear
The earth's environment has been composed in a way which sustains life on this planet. Through on process, the different constituents of the atmosphere are consumed and through the
Define the major source of vitamin A? The major source of vitamin A, as you may be aware, is the carotenoid pigments which are synthesized by plants. Several carotenoid possess
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are synthetic auxins and what are their uses? Synthetic auxins, like indolebutyric acid (IBA) and naphthalenic acid (NAA) are substances same to IAA (a natural auxin) but
Q. What is signifying when it is said that a bacteria is an obligate anaerobe? Obligate anaerobes are those living beings that do not survive in the presence of oxygen. For exa
Which factors are altered when cells are moved from an in vivo to an in vitro environment, and how do cells respond to these changes?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd