Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Proteins as Enzymes? From conception to death, living cells use oxygen and metabolize fuel. Cells synthesize new products, degrade others, and generally are in a state o
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
what are the reactants and the products of photosynthesis? under the thylakoid, stroma,and combined
How many cells are in the human body? According to "The Handy Science Answer Book" noted by the Science and Technology Department of the Carnegie Library of Pittsburgh (1994) th
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
(1) From the above gateway reaction (entry clone and destination vector); (i) which plasmid will be selected for when transformed into E.coli (A or B) and why? (ii) which an
How does aldosterone act and where is it produced? Aldosterone is a hormone that acts upon the nephron tubules stimulating the resorption of sodium. Thus it contributes to the
Explain the Culture Media and Its Types? A culture medium (Pl. media), we already know, is a solid or liquid preparation containing all the nutrients required by microorganisms
Define about the Metabolism of Copper? In food, most copper is present as Cu 2+ and some as Cu 1+ . This copper is bound to organic compounds especially protein. Gastric HCI p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd