Structure of water, Biology

Assignment Help:

STRUCTURE OF WATER

It may interest you to know that water is a universal solvent and is a major constituent of all living organisms. Earth is the only planet where water exists in all its three phases. Availability and absence of water influence the distribution and abundance of plants, animals as well as human societies. The uniqueness of water is due to its structure and properties which are discussed in the following lines.

A water molecule (H2O) consists of two atoms of hydrogen and one oxygen. The hydrogen atoms share their electrons with the oxygen atom. The shared electrons become asymmetrically distributed. The negatively charged electrons are attracted more towards the oxygen nucleus which is more positively charged (8+) than a hydrogen nucleus (I+). Consequently, the hydrogen nuclei develop a smaH (delta) positive charge and the oxygen nucleus a small (delta) negative charge. Such a molecule is known as a polar molecule (Figure shown below). Remember that overall a water molecule is neutral since the number of electrons is equal to the number of protons.

1402_structurewater.jpg


Related Discussions:- Structure of water

Porifera, what are the general characteristicss of porifera

what are the general characteristicss of porifera

Ecology, What is the role of ecology to the evolution theory.

What is the role of ecology to the evolution theory.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Difference between self pollination and cross pollination, What is differen...

What is difference between self pollination and cross pollination? Which of the two modes of pollination contributes more to the plant diversity? Self pollination take places w

Medicines and drugs - impacts on biodiversity, Q. Medicines and Drugs - imp...

Q. Medicines and Drugs - impacts on biodiversity? The World Health Organization (WHO) has listed over 21,000 plant names (including synonyms) that have recorded medical uses ar

Deifition, what''s the define of mitochodria

what''s the define of mitochodria

What is meant by saturation or unsaturation of oils and fats, What is meant...

What is meant by saturation or unsaturation of oils and fats? When it is said that a triglyceride is saturated it means that in its molecule the carbon chain is bound in its ma

Determine some dietary sources of vitamin c, Determine some Dietary Sources...

Determine some Dietary Sources of Vitamin C? Fruits (particularly citrus fruits), vegetables are the best sources of ascorbic acid. Amla is the richest source of ascorbic acid.

Explain injection rate and volume, Q. Explain Injection Rate and Volume? ...

Q. Explain Injection Rate and Volume? This is best achieved by injecting directly into the ventricular chamber. Midcavitary position of the catheter ensures that there is no ve

Heterotropic nutrition, what is the meaning of heterotropic mode of nutrit...

what is the meaning of heterotropic mode of nutrition. with examples.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd