Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
State in detail about rocks
A mass of mineral matter is called rock. It may be composed of one or more minerals. Some rocks are hard and compact e.g. granite and basalt, while others are loose and feebly aggregated such as sandstone and loose sand. Each rock possesses certain properties like colour, structure, specific gravity, cleavage and mineralogical make up. These properties can be used to identify a rock -mineral.
Define Body Composition - Geriatric Nutrition? After 30 years of age 1-2% decline in lean body mass annually is observed. The total body water, bone mass and lean body mass
Explain Implant Integrity Implant Integrity: A horizontal dark line at the abutment level is most probably due to screw-loosening and separation of elements. This may happen
Describe Class Agnatha in details? Class Agnatha takes its name from the Greek word "gnathos," which means jaw, and "a," which is the prefix for "without." These jawless fishes
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the vascular bundles? How does configuration of the vascular bundles within the stem differentiate monocots from dicots? The Vascular bundles are segments of xylem and
economic importance
what is a homologous chromosome
Q. Define characteristic of Doppler Echocardiographic? Ans. Doppler findings of cardiac tarnponade are based on the following characteristic respiratory variations in intr
Q. What are carcinogens? The Carcinogens are factors capable of producing neoplasias and any mutagen, a substance that can induce DNA mutation, is a potential carcinogen. Insta
Wat type of animal is tick and weevil?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd