Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Specify the term in detail - Swim bladder.
Found in bony fish, this gas-filled chamber is used to main neutral buoyancy. Oxygen in blood is added or removed as required. Swim bladder in some fishes opens into digestive system allowing these fish to swallow air instead.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
GOLGI APPARATUS Camillo Golgi in 1898 discovered a reticular structure in the cytoplasm of nerve cells with the help of metal impregnation technique using silver nitrate for whic
During digestion, the role of pancreatic lipase is to: -digest cholesterol into dimethlyalpyrophosphase -inhibits interactions between lipids and bile salts -hydrolize TG
Give two examples in each case of organs or tissues in which you would expect (a) meiosis, (b) mitosis to be taking place a) Meiosis is likely to
Q. A netlike membranous complex of superposed flat saccules with vesicles detaching from the extremities seen in electronic microscopy. What is the observed structure? What is its
Define the Ascorbic Acid - Basic Concepts? Ascorbic acid is a water-soluble vitamin, whose structure is shown in Figure. You would have noticed that its structure resembles glu
Q. How can the visual deficiencies known as myopia and hypermetropia be optically explained? Myopia is the visual condition in which the images are formed previous to (in front
Mineralisation and Humification As a result of physical weathering, the rocks are broken down into smaller particles. But this is not the true soil, and plants cannot grow well
How do respiratory pigments act? Respiratory pigments are oxygen-carrying molecules present in the blood. When the oxygen concentration is high, for instance, in the pulmonary
Diabetes mellitm This anabolic hormone exerts its action on key glycolytic enzymes thus leading to the conversion of glucose to pyruvate as explained under the regulation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd