Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
All the cells present in the body contain genes and an approach targeted to modulate the expression of genes is known as gene therapy. This novel approach has emerged by the end of 20th century and comes up with a promise of treating a large number of genetic disorders by ultimately modifying the gene expression (Jin et al, 2008). The two forms of gene therapy are somatic and germ line.
Somatic gene therapy: During this therapeutic approach, the genetic diseases are treated by inserting recombinant genes into non-reproductive or somatic cells. This kind of approach is limited to the patient and does not get transmitted to the future generations of. A normal copy of the malfunctioning gene is inserted into the mutant cells due to which an improvement in the disease phenotype is observed (Dorin, 1996). In the recent past, this technique has been found to be successful in case of familial hypercholesterolaemia and adenosine deaminase deficiency. For treating these disorders hepatocytes and T cells have been used for gene transfer respectively (Dorin, 1996). It has also shown significant success in case of cystic fibrosis and cancer. Various vehicles, like viral and non viral vectors help in the introduction of the genetic material into the mutated cells (Elias and Annas, N.D). This therapeutic approach is categorized into three sections:
However this approach produces short term results as the tissues die and get replaced with other cells.
What is the mode of nutrition in fish,human,amoeba,scorpian & toad ?
What are Fitness Tests? Testing is an important evaluation tool for the sports performer as it gives them an insight into their current physical condition and the effectiveness
Water Cycle (Hydrological Cycle) The movement of water on the earth is continuous and forms many complex inter-related loops (Figure shown below). Cycling of water involves atm
Which of the following abnormal blood work results is most closely associated with a diagnosis of multiple myeloma? A. Extremely high levels of abnormal lymphocytes B. Low potassiu
Q How does the amoeboid movement occur and what are examples of beings and cells that use such movements for locomotion? Amoeboid movements are created by cytoplasmic movements
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Pituitary The pituitary is also known as hypophysis. It is composed of two embryologically distinct tissue. The anterior pituitary or adenohypophysis is derived from the roof
What are the advantages of the closed circulatory system over the open circulatory system? The closed circulatory system is more efficient. As blood circulates only inside bloo
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Drug effects on Metabolism of dietary components? Drugs can also compete with, or inhibit, the metabolic conversion of some micronutrients to their active metabolites,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd