Single vessel disease, Biology

Assignment Help:

Single Vessel Disease (SVD) :  They do well on medical treatment or with angioplasty. However if proximal LAD is significantly blocked and LIMA can be used as a conduit, surgery gives excellent results. In a patient with proximal LAD lesion if the ejection fraction (EF) is less than 50 per cent and non-invasive tests show extensive reversible ischaemia, surgery is the best choice.

 


Related Discussions:- Single vessel disease

Fatty Acids, How can I construct a fat molecule whose fatty acid tails are ...

How can I construct a fat molecule whose fatty acid tails are 4 carbon atoms long

Cardiac transplantation, For patients with end-stage heart failure, cardiac...

For patients with end-stage heart failure, cardiac transplantation has become a promising therapy especially with the advent of  immunosuppressive therapy and more careful screenin

Evolution, write similaritie between the two species?

write similaritie between the two species?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Driving force - mineral nutrition, Driving Force - Mineral Nutrition ...

Driving Force - Mineral Nutrition Let us now find out what is the driving force involved in protein mediated transport. Many membrane transport proteins allow specific solute

Explain conservative substitution, Conservative Substitution: The nucleoti...

Conservative Substitution: The nucleotide mutation that alters the amino acid sequence of protein, but which causes substitution of one amino acid with another which has a side ch

Which organs are protected by the skull, Which organs are protected by (a) ...

Which organs are protected by (a) the skull, (b) the rib cage, (c) the vertebrae?   a) The skull safe the brain, b) the rib cage safes the heart, lungs, liver and spleen,

Define functions of sodium and chloride, Define Functions of sodium and chl...

Define Functions of sodium and chloride? So far you have learnt that most minerals participate in important functions of body as they support the activity of specific enzymes.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd