Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Single Vessel Disease (SVD) : They do well on medical treatment or with angioplasty. However if proximal LAD is significantly blocked and LIMA can be used as a conduit, surgery gives excellent results. In a patient with proximal LAD lesion if the ejection fraction (EF) is less than 50 per cent and non-invasive tests show extensive reversible ischaemia, surgery is the best choice.
How can I construct a fat molecule whose fatty acid tails are 4 carbon atoms long
For patients with end-stage heart failure, cardiac transplantation has become a promising therapy especially with the advent of immunosuppressive therapy and more careful screenin
Define
write similaritie between the two species?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Driving Force - Mineral Nutrition Let us now find out what is the driving force involved in protein mediated transport. Many membrane transport proteins allow specific solute
Conservative Substitution: The nucleotide mutation that alters the amino acid sequence of protein, but which causes substitution of one amino acid with another which has a side ch
Which organs are protected by (a) the skull, (b) the rib cage, (c) the vertebrae? a) The skull safe the brain, b) the rib cage safes the heart, lungs, liver and spleen,
Define Functions of sodium and chloride? So far you have learnt that most minerals participate in important functions of body as they support the activity of specific enzymes.
what is cell?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd