Silver point extended below canal orifice, Biology

Assignment Help:

Silver point extended below canal orifice

-    Ultra-sonic tip
-    Microtube tape:

  • The post removal system (PRS)
  • Trephine bur
  • Masserann kit

- Do trimming by bur --->create space around the silver point---> insert trephine tube ----> start rotation ----> remove fracture part from the canal.


Related Discussions:- Silver point extended below canal orifice

Blood pressure, bloodpressure will be more in _ in than in_

bloodpressure will be more in _ in than in_

New Technology, What is the best microscope to get a detailed view of the p...

What is the best microscope to get a detailed view of the parts inside of a preserved plant cell

Define carbohydrates requirements in human body, Define Carbohydrates Req...

Define Carbohydrates Requirements in Human Body? Carbohydrates: High carbohydrate diets are beneficial at HA. The advantage of high carbohydrate diet is that respiratory quo

Lymphatic drainage of the heart, The heart is drained by vessels that trave...

The heart is drained by vessels that travel in the interventricular and atrioventricular grooves. One set runs in the anterior part of the atrio-ventricular groove. The vessels of

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain faecal coliforms - microbiological study of water, Explain the Faec...

Explain the Faecal Coliforms - Microbiological Study of Water? The faecal coliforms include a wide range of bacteria, many of which are not primarily the intestinal bacteria. T

What are the differences between astral and anastral mitosis, What are the ...

What are the differences between astral and anastral mitosis? Astral mitosis is that in which there is structure of the aster, a structure made by the centrioles. Anastral mito

Which of the vertebrate classes are warm-blooded, Which of the vertebrate c...

Which of the vertebrate classes (a) are 'warm-blooded', (b) reproduce by laying eggs?   (a) Birds and mammals are 'warm-blooded'. (b) Fish, Amphibia, Reptiles

What is normalisation of inverted t-waves?, Q. What is Normalisation of Inv...

Q. What is Normalisation of Inverted T-Waves? In patients with flat or inverted T-waves at rest, the evolution to an upright T-wave has been considered by some to be a sign of

Nervous system - cranial nerves, CRANIAL NERVES 12 pairs. Total weig...

CRANIAL NERVES 12 pairs. Total weight 12 gms. Upto amphibian 10 pairs cranial nerves are present. 1, 2, 8, - sensory. 3, 4, 6, 11, 12, motor. 5, 7, 9, 10 - mixed. 3

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd