Sex-limited traits, Biology

Assignment Help:

Sex-Limited Traits

Sex Limited Traits are traits expressed only in one sex, although the genes controlling thcm arc prcscnt as wcll as transmitted to both thc sexes. Therefore, males and femalcs with thc bamc genotype, with rcspcct to a particular locus may have different phenotypes.

Sex-Limited Traits arc determined by autosomal genes, whose phenotypic expression is determined by the presence or absence of one of the sex hormones. Since sex hormones are the limiting factors, rhc phenotypic expression of these genes is limited to onc sex or the other. The most obvious exanlples are the secondary sex characteristics. Beard development in human beings is one such sex-limited character as men have beards, and woman normally do not. Yet studies indicate no significant differences between thc sexes in number of hairs per unit area of skin surface except in their development. This appears to clepend on sex hornlone production. Any disturbance in these hol-rnones in women rnay result in the development of beard. Similarly, the full development of breasts in females, and presencc of prostate glands in males are thc examples of sex-limited traits seen in human beings. Traits like egg laying in chickens, oviposition behaviour in insects are somc other such examples. Milk production in mammals is limited to females, but certain bulls are in great demand among dairy breeders and artificial inscinination associations because their mothers and daughters have incresed milk production records.


Related Discussions:- Sex-limited traits

Explain about suspensions, Explain about Suspensions Sol is a colloidal...

Explain about Suspensions Sol is a colloidal system, in which solid particles are dispersed in a liquid. When the particles of a solid are separated into large aggregates of pa

Skin, what is the advantage of being dark skinned?

what is the advantage of being dark skinned?

Define metabolic utilization of carbohydrates, Define Metabolic utilization...

Define Metabolic utilization of carbohydrates? Following absorption, the monosaccharides enter the portal circulation and are carried to the liver. Both galactose and fructose

Explain procedure for gram staining of bacterial cultures, Explain Procedur...

Explain Procedure for Gram Staining of Bacterial Cultures? Now carry out the exercise following the steps enumerated herewith. 1. Prepare bacterial smear on a clean, non-gre

How do calcium ions participate in muscle contraction, Q. How do calcium io...

Q. How do calcium ions participate in muscle contraction? Why do both muscle relaxation and muscle contraction spend energy? In the muscle cells calcium ions are stored within

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the magnitude n, Three point charges are located at the corners of ...

Three point charges are located at the corners of an equilateral triangle. Find the magnitude and direction of the net electric force on the 1.60 uC charge. (Let A = 1.60 uC, B= 6.

#title. Zoology, Can you give me an explanation on the osmoregulation of th...

Can you give me an explanation on the osmoregulation of the Phyla Cnidaria, Ctenophora, Porifera and the Protozoa?

Explain why methionine is the first amino acid, Explain why methionine is t...

Explain why methionine is the first amino acid in every growing polypeptide. The tRNA that pairs with the start codon on mRNA carries methionine. RNA having ribose; DNA contain

Define the herbals, Q. Define the Herbals? During the Middle Ages, foll...

Q. Define the Herbals? During the Middle Ages, following the decline of the Greek and Roman civilisations, little significant botanical progress was made. The early herbals (i.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd