Sex determination - reproduction, Biology

Assignment Help:

Sex Determination - Reproduction

Sex, whether an individual will be a male or a female is determined at fertilisation, and this directs and controls all the later processes involved in male-female differentiation of the genital system. The genetic determination however is not final and irrevocable. Many internal and external environmental factors come into operation during the developmental process and modify or completely reverse the sexual constitution of the individual. Sex which is established at fertilisation, depends upon the "sex" chromosomes contributed by the parents. You are aware that cells of multicellular organisms contain two types of chromosomes; autosomes and sex chromosomes. In human for example, there are twenty two pairs of autosomes and one pair of sex chromosomes.

In mammals, most frogs, some fishes, and dipterus insects there are two types of sex chromosomes, X and Y. Y chromosome is strongly "male determining". The zygote bearing XY chromosomes gives rise to male and it is called heterozygote, where as zygote of XX chromosomes develops into a female, and it is homozygote. Since a mammalian male is a heterogamete, containing XY chromosomes, therefore, half of the spermatozoa bear X chromosomes and the other half Y chromosomes. A mammalian female is a homogamete containing XX chromosomes, therefore ova contain only the X chromosomes. The union of the spermatozoon bearing X chromosome with the egg gives rise to a female and union of the spermatozoon bearing Y chromosome with the egg will be the genetic male. In birds, female is the heterogametic sex. The small chromosome, equalent to the Y in mammals, is designated by the letter W, and the X chromosome is designated in this case as , Z. Half of the eggs carry a W chromosome and the other half a Z chromosome. All of the sperms carry a Z chromosome. The homozygous (ZZ) condition produces males, and the heterozygous (ZW) produces females. This is the type of mechanism that operates in birds, most reptiles, salamanders, some fishes and insects. XX-XY type of sex determination is called mammalian type of sex determination and ZZ-ZW type is called avian type of sex determination.

 


Related Discussions:- Sex determination - reproduction

Toxic agents present in which food, Toxic agents present in food which inte...

Toxic agents present in food which interfere with thyroxine synthesis lead to the development of: 1. toxic goitre 2. cretinism 3. simple goitre 4. thyrotoxicosis si

How pathogenic bacteria cause diseases, What are some mechanisms by which p...

What are some mechanisms by which pathogenic bacteria cause diseases? Why is this knowledge important? Pathogenic bacteria have characteristics called as virulence factors that

Cytokinins - apical dominance, Cytokinins - Apical Dominance Cytokinin...

Cytokinins - Apical Dominance Cytokinins are also involved in the regulation of apical dominance. Wickson and Thimann studied the interaction of cytokinins and auxins in contr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Organogenesis - plant tissue and organ culture, Organogenesis - Plant Tissu...

Organogenesis - Plant Tissue and Organ Culture Organogenesis refers to the differentiation of organs such as roots, shoots or flowers. Shoot bud differentiation may occur dire

Explain how inhibition might contribute, We now understand that mutations t...

We now understand that mutations that cause the inhibition of apoptosis are found in tumors. Because proliferation itself is not induced by the inhibition of apoptosis, explain how

What is the aim of milling, What is the aim of milling The aim of milli...

What is the aim of milling The aim of milling (the process including crushing and grinding) is to obtain preferentially a flour, in which the constituents of the endosperm cell

Homework, The Waldorf family was caught in a fire but escaped. Unfortunatel...

The Waldorf family was caught in a fire but escaped. Unfortunately, the father and daughter suffered burns. The father had second-degree burns on his entire chest, abdomen, and bot

How is price mechanism or supply and demand concerned, How is price mechani...

How is price mechanism or supply and demand concerned?   The price mechanism or supply and demand: The price mechanism or supply and demand is concerned with how buyers

Benefits of computerization, Benefits of Computerization Computerizati...

Benefits of Computerization Computerization were the following benefits in nursing: Improved professional care  Better accuracy (by decreasing human error)  Effect

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd