Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Does pH affect the enzyme activity? The concentrations of hydrogen ions in solution affect the enzyme activity. Each enzyme has utmost efficiency under an optimum p H . S
Thorax and Lungs: The lungs, a pair of conical-shaped organs lie in the thoracic cavity, protected by the bony thorax composed of the sternum and ribs a interiorly and r
Q. Photosynthesis rate varies as per to the photic energy intensity. Does the same take place in aerobic respiration? What do happen to the glucose balance as a result of these var
Which invertebrate groups possess one, three, four or all of the features below? Segmented bodies, hard exoskeleton, jointed legs, compound eyes, three pairs of walkin
Pulse Oximetry: Procedure: Pulse Oximetry is a safe and simple method of assessing oxygenation. An advantage is that this method is noninvasive and continuous. Previously,
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Brooke's Formula: a) Fluid requirement b) Estimate the accurate/approximate weight of the patient c) First 24 hours Colloids (blood, plasma, dextran) 0.5 ml
How do the repairing enzymes of the genetic system act? There are enzymes inside the cells that detect errors or alterations in DNA molecules and begin a repair of those errors
Cell plate: In the plants, a membrane-bound space produced during the process of cytokinesis by the vesicles of the Golgi apparatus. The cell plate fuses with plasma membrane, sep
Explain about the Energy Requirements in elderly? Based on the Benedict - Harris equation for men and women, the daily energy requirements can be calculated. For Men: 66 t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd