saprophytic, Biology

Assignment Help:
what is saprophytic

Related Discussions:- saprophytic

Does ph affect the enzyme activity, Q. Does pH affect the enzyme activity? ...

Q. Does pH affect the enzyme activity? The concentrations of hydrogen ions in solution affect the enzyme activity. Each enzyme has utmost efficiency under an optimum p H . S

Thorax and lungs, Thorax and Lungs: The  lungs, a pair of conical-shap...

Thorax and Lungs: The  lungs, a pair of conical-shaped organs lie  in  the  thoracic cavity, protected by the bony  thorax composed of the  sternum and ribs a interiorly and r

On whcih factor photosynthesis rate depends, Q. Photosynthesis rate varies ...

Q. Photosynthesis rate varies as per to the photic energy intensity. Does the same take place in aerobic respiration? What do happen to the glucose balance as a result of these var

Invertebrate groups possess segmented bodies, Which invertebrate groups pos...

Which invertebrate groups possess one, three, four or all of the features below?  Segmented bodies, hard exoskeleton, jointed legs, compound eyes, three pairs of walkin

Pulse oximetry - diagnostic tests, Pulse Oximetry: Procedure: Pulse Ox...

Pulse Oximetry: Procedure: Pulse Oximetry is a safe and  simple method of assessing oxygenation. An  advantage is  that this method  is noninvasive and continuous. Previously,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Brookes formula, Brooke's  Formula: a)  Fluid  requirement  b)  Es...

Brooke's  Formula: a)  Fluid  requirement  b)  Estimate the accurate/approximate weight of the patient  c)  First  24  hours  Colloids (blood, plasma, dextran) 0.5 ml

How do the repairing enzymes of the genetic system act, How do the repairin...

How do the repairing enzymes of the genetic system act? There are enzymes inside the cells that detect errors or alterations in DNA molecules and begin a repair of those errors

Define cell plate, Cell plate:  In the plants, a membrane-bound space produ...

Cell plate:  In the plants, a membrane-bound space produced during the process of cytokinesis by the vesicles of the Golgi apparatus. The cell plate fuses with plasma membrane, sep

Explain about the energy requirements in elderly, Explain about the Energy ...

Explain about the Energy Requirements in elderly? Based on the Benedict - Harris equation for men and women, the daily energy requirements can be calculated. For Men: 66 t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd