Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Oxaloacetate has two main roles. It is an intermediate which is consumed in gluconeogenesis and it is also a key intermediate in the citric acid cycle where it fuses with acetyl CoA to form citrate, finally being regenerated by the cycle. Thus pyruvate carboxylase produces oxaloacetate for gluconeogenesis but also must maintain oxaloacetate stages for citric acid cycle function. Intended for the latter reason the activity of pyruvate carboxylase depends absolutely on the presence of acetyl CoA; the biotin prosthetic set of the enzyme cannot be carboxylated unless acetyl CoA is bound to the enzyme. This allosteric activation by acetyl CoA ensures which more oxaloacetate is made when excess acetyl CoA is available. In this role of maintaining the level of citric acid cycle intermediates and the pyruvate carboxylase reaction is learn to be anaplerotic which is filling up.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Stress and Psychosocial Tension in lifestyle risk factors? Stress and psychosocial tension are other lifestyle factors in initiating coronary artery disease and precipi
What are the two big groups into which cells are classified? Cells can be divided as eukaryotic or prokaryotic. Prokaryotic cell is the cell that without a delimited nucleus
(1) The 7,893 bp plasmid shown below was digested with a series of restriction enzymes (P = PstI, B = BamHI, S = SalI, X = XbaI). Answer the questions below. a) Indicate
Myocarditis Myocarditis is inflammation of the myocardium, of the heart muscles. i) Causes Infection: . Wrus, bacteria, fungus, parasites Non-infection: Radi
I have a test online it is timed 30 minutes on Anatomy and Physiology I need an expert who is an expert in this subject to take it for me
Define Clinical Manifestations and Nutritional Problems Associated with Cancer? In the previous section we learnt that cancer results in several changes in the metabolism of ca
formulation of RDA
Explain the Cost Benefit Analysis? Cost-benefit analysis: Cost benefit analysis is a useful tool to establish the priority of a particular health service action. In this, both
Q. Use of Protective Eyewear as personal protective equipment? Protective lenses must be worn by dental personnel: 1. when performing procedures that can cause spatter or ae
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd