Pyruvate carboxylase activation, Biology

Assignment Help:

Oxaloacetate has two main roles. It is an intermediate which is consumed in gluconeogenesis and it is also a key intermediate in the citric acid cycle where it fuses with acetyl CoA to form citrate, finally being regenerated by the cycle. Thus pyruvate carboxylase produces oxaloacetate for gluconeogenesis but also must maintain oxaloacetate stages for citric acid cycle function.  Intended for the latter reason the  activity  of  pyruvate  carboxylase   depends  absolutely  on  the  presence  of acetyl  CoA; the biotin  prosthetic  set  of the enzyme  cannot  be carboxylated unless acetyl  CoA is bound  to the enzyme.  This allosteric activation by acetyl CoA ensures which more oxaloacetate is made when excess acetyl CoA is available. In this role of maintaining the level of citric acid cycle intermediates and the pyruvate carboxylase reaction is learn to be anaplerotic which is filling up.

 


Related Discussions:- Pyruvate carboxylase activation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain stress and psychosocial tension in lifestyle risk, Explain Stress a...

Explain Stress and Psychosocial Tension in lifestyle risk factors? Stress and psychosocial tension are other lifestyle factors in initiating coronary artery disease and precipi

What are the two big groups into which cells are classified, What are the t...

What are the two big groups into which cells are classified? Cells can be divided as eukaryotic or prokaryotic. Prokaryotic cell is the cell that without a delimited nucleus

List the exact sizes of the fragments of digests, (1)  The 7,893 bp plasmid...

(1)  The 7,893 bp plasmid shown below was digested with a series of restriction enzymes (P = PstI, B = BamHI, S = SalI, X = XbaI). Answer the questions below.  a) Indicate

Myocarditis, Myocarditis Myocarditis is inflammation of the myocardiu...

Myocarditis Myocarditis is inflammation of the myocardium, of the heart muscles. i) Causes Infection: . Wrus, bacteria, fungus, parasites Non-infection: Radi

Anatomy and Physiology, I have a test online it is timed 30 minutes on Anat...

I have a test online it is timed 30 minutes on Anatomy and Physiology I need an expert who is an expert in this subject to take it for me

Define clinical manifestations associated with cancer, Define Clinical Mani...

Define Clinical Manifestations and Nutritional Problems Associated with Cancer? In the previous section we learnt that cancer results in several changes in the metabolism of ca

RDA.., formulation of RDA

formulation of RDA

Explain the cost benefit analysis, Explain the Cost Benefit Analysis? C...

Explain the Cost Benefit Analysis? Cost-benefit analysis: Cost benefit analysis is a useful tool to establish the priority of a particular health service action. In this, both

Use of protective eyewear as personal protective equipment, Q. Use of Prote...

Q. Use of Protective Eyewear as personal protective equipment? Protective lenses must be worn by dental personnel: 1. when performing procedures that can cause spatter or ae

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd