Precautions for selective and differential medium, Biology

Assignment Help:

Precautions for Preparation of Selective and Differential Medium

1. Dissolve ingredients one by one.

2. Check and set the medium to appropriate pH.

3. Autoclave the medium properly.

4. Dispensing of the medium should be done aseptically.

 


Related Discussions:- Precautions for selective and differential medium

Pulmonary artery vary from pulmonary vein, In what two ways will the compos...

In what two ways will the composition of blood coming from the pulmonary artery vary from that going to the pulmonary vein? Blood in the pulmonary artery will have less oxygen

What is the function of lh in the menstrual cycle, What is the relationship...

What is the relationship between the estrogen level and the LH level in the menstrual cycle? What is the function of LH in the menstrual cycle and when does its blood concentration

Why is the fish circulation classified as simple circulation, Why is the fi...

Why is the fish circulation classified as a simple and complete circulation? Complete circulation is that in which there is no mixture of venous blood and arterial blood. As ci

Zoology of Protozoa, How does the metachronal waves form in the ciliary row...

How does the metachronal waves form in the ciliary row of protozoa ? Explain the cilia beating mechanism associates with it.

Define preterm and low birth weight, Define Preterm and Low Birth Weight? ...

Define Preterm and Low Birth Weight? The foetal and neonatal health is mainly dependent on the birth weight and it has been well recognized that perinatal (from birth upto one

What is organ system in human biology, Organ Systems :  Organisms are comp...

Organ Systems :  Organisms are composed of organ systems. Each organ system is made up of several different organs. For example, the digestive system is composed of several organ

Movements, Normal 0 false false false EN-IN X-NONE ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Chest x-ray, Increase in cardio-thoracic ratio is a relatively specific ind...

Increase in cardio-thoracic ratio is a relatively specific indicator of left ventricular end-diastolic volume. Left atrial enlargement is seen as double density shadow, lifting up

Explain ledge bypass - non-surgical endodontic retreatment, Explain Ledge b...

Explain Ledge bypass - Non-surgical Endodontic Retreatment   Ledge bypass - StSt not NiT cause it has shape memory Ledges from outside the curvatures. The file t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd