Polygonum type - monosporic embryo sacs, Biology

Assignment Help:

Polygonum Type - Monosporic Embryo Sacs

The embryo sac is formed from the chalazal megaspore in the tetrad and is eight-nucleate. The development of the embryo sac begins with elongation of the functional megaspore. Initially, the megaspore cytoplasm is non-vacuolated but later small vacuoles appear which fuse to form a large vacuole. The spindle of the nuclear division in the megaspore is oriented along the long axis of the cell. Wall is not formed after the nucleus divides.

A large central vacuole appears between the two daughter nuclei. It expands and pushes the nuclei towards the opposite poles of the cell. Both the nuclei divide to form four nuclei, two at each pole. By a further division an eight nucleate condition is reached. This is followed by cellular organisation of the embryo sac. Out of the four nuclei at the micropylar end of the sac, three organize into egg apparatus and the fourth is left free in the cytoplasm of the central cell as the upper polar nucleus. Similarly, three nuclei of the chalazal quartet form three antipodal cells; the fourth one functions as the lower polar nucleus. Eventually, the latter comes to lie close to the upper polar nucleus.


Related Discussions:- Polygonum type - monosporic embryo sacs

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Fats requirements for ulcerative colitis, Q. Fats requirements for ulcerati...

Q. Fats requirements for ulcerative colitis? Usual foods, which contain fats (invisible or inherent fat), are permitted but not fried foods, as they are not easily digested due

Explain chemical phase of photosynthesis, Q. Where do the photochemical and...

Q. Where do the photochemical and the chemical phase of photosynthesis occur? The photochemical phase of the photosynthesis procedure occurs mainly on the thylakoids the green

Indications for surgery-aortic valve disease, Indications For Surgery :...

Indications For Surgery :  The normal aortic valve area in the adult is about 3-4 cm2. Significant symptoms occur when the valve area is seduced to 1/4"' the normal area

Briefly explain how amniocentesis used in genetic screening, Briefly explai...

Briefly explain how amniocentesis and chorionic villi sampling are used in genetic screening. A small sample is removed from the amniotic fluid surrounding the fetus or from t

Define gelatin - tests for presence of exoenzymatic activity, Explain Gelat...

Explain Gelatin - Tests for Presence of Exoenzymatic Activity? Gelatin is an incomplete protein as it lacks amino acid tryptophan. It is a major component of connective tissue

How rb proteins phosphorylation affects the cell cycle, How Rb protein's ph...

How Rb protein's phosphorylation state affects the cell cycle and cancer progression. please put link or citation of where you find information.

Principle for determination of blood glucose, Define Principle for Determin...

Define Principle for Determination of Blood Glucose by Nelson Somogyi Method? Proteins are precipitated from the sample and protein free filtrate is heated with alkaline copper

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd