Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Polygonum Type - Monosporic Embryo Sacs
The embryo sac is formed from the chalazal megaspore in the tetrad and is eight-nucleate. The development of the embryo sac begins with elongation of the functional megaspore. Initially, the megaspore cytoplasm is non-vacuolated but later small vacuoles appear which fuse to form a large vacuole. The spindle of the nuclear division in the megaspore is oriented along the long axis of the cell. Wall is not formed after the nucleus divides.
A large central vacuole appears between the two daughter nuclei. It expands and pushes the nuclei towards the opposite poles of the cell. Both the nuclei divide to form four nuclei, two at each pole. By a further division an eight nucleate condition is reached. This is followed by cellular organisation of the embryo sac. Out of the four nuclei at the micropylar end of the sac, three organize into egg apparatus and the fourth is left free in the cytoplasm of the central cell as the upper polar nucleus. Similarly, three nuclei of the chalazal quartet form three antipodal cells; the fourth one functions as the lower polar nucleus. Eventually, the latter comes to lie close to the upper polar nucleus.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Fats requirements for ulcerative colitis? Usual foods, which contain fats (invisible or inherent fat), are permitted but not fried foods, as they are not easily digested due
Q. Where do the photochemical and the chemical phase of photosynthesis occur? The photochemical phase of the photosynthesis procedure occurs mainly on the thylakoids the green
Disadvantages of Protozoa
Indications For Surgery : The normal aortic valve area in the adult is about 3-4 cm2. Significant symptoms occur when the valve area is seduced to 1/4"' the normal area
Briefly explain how amniocentesis and chorionic villi sampling are used in genetic screening. A small sample is removed from the amniotic fluid surrounding the fetus or from t
Explain Gelatin - Tests for Presence of Exoenzymatic Activity? Gelatin is an incomplete protein as it lacks amino acid tryptophan. It is a major component of connective tissue
How Rb protein's phosphorylation state affects the cell cycle and cancer progression. please put link or citation of where you find information.
what is osismosi
Define Principle for Determination of Blood Glucose by Nelson Somogyi Method? Proteins are precipitated from the sample and protein free filtrate is heated with alkaline copper
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd