Phytoflagellates - protozoan, Biology

Assignment Help:

Phytoflagellates – Protozoan

Phytoflagellates are autotropbs that possess chlorophyll or other related pigments, and store food as fats, oils and starches (other than glycogen). They are free-living and assigned often to the algal phyla.

Examples are: Euglena, Chlamydomonas, Volvox, Peranema, Gonium, Pandorina, dinoflagellates.

1407_Phyto flagellates.png

Figure: Diversity among phytoflagellates Gonium and Pandorina are colonial. Noctiluca and Ceratium are dinoflagellates.

Dinoflagellates an interesting group of phytoflagellates with brown or yellow chromatophore although some are color less. Some species, Noctiluca for example are bioluminesceit, Dinoflagellates can also damage other organisms when they reproduce in profusion, producing toxic substances that may be highly poisonous for other living organisms.


Related Discussions:- Phytoflagellates - protozoan

Median sternotomy approach-types of surgery, Median Sternotomy Approach :  ...

Median Sternotomy Approach :  The preferred approach these days is through a median sternotomy. Pericardiectoiny proceeds in the same way as done through left thoracotomy, by

What is the root cap, What is the root cap? The root cap is a protectiv...

What is the root cap? The root cap is a protective structure located in the tip of the growing root. It protects the meristematic tissue of the root forming a cap that surround

Changes in animal life during xerosere, Changes in Animal Life during Xeros...

Changes in Animal Life during Xerosere Just like the hydrosere, there occur successive changes in animal life during the xerosere. A few mites are usually found associated wi

What are the differentiations of the cell membrane, Q. What are the differe...

Q. What are the differentiations of the cell membrane? In some kind of cells, the cell membrane presents differentiations that are necessary for the specific functions of the c

Compare & contrast replication, Compare and contrast replication, transcrip...

Compare and contrast replication, transcription, and translation based on the following criteria.   Criteria Replication Transcription

Fiehes test and aniline chloride test, Q. Fiehes test and Aniline chloride ...

Q. Fiehes test and Aniline chloride test? Determine the adulteration in the given honey sample by Fiehe's test and Aniline chloride test This activity will help you to: •

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the main biological functions of water, Q. What are the main biolo...

Q. What are the main biological functions of water? Ans. Water is the basic solvent for chemical reactions of living beings; it is the main means of substance transportati

Define the energy requirement to avoid underweight problem, Define the Ener...

Define the Energy requirement to avoid Underweight problem? The total calorie intake should be 500 to 1000 Kcal in excess of the daily needs in order to result a gain in weight

What are the three major types of passive transport, Q. What are the three ...

Q. What are the three major types of passive transport? The three main types of passive transport are simple osmosis, diffusion and facilitated diffusion.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd