Organisms contain enzymes, Biology

Assignment Help:

Some organisms contain enzymes that condense a fatty alcohol and a fatty acid to generate wax esters. Draw decanol, plamitic acid (C16:0 fatty acid) and the resulting wax ester generated by a dehydration reaction between both molecules


Related Discussions:- Organisms contain enzymes

Venous drainage of the heart, The coronary sinus is the main vein of the he...

The coronary sinus is the main vein of the heart and is about 3 cm. long. It lies in the coronary sulcus at the posterior surface of  the heart in the posterior atrio-ventricular g

Determine the name of material used for bcc, Determine the name of Material...

Determine the name of Material used for BCC You must be interested to know about type of material you can prepare and some material is available in hospitals and clinics for us

differences between rna and dna , Ribo Nucleic Acid contains OH group at s...

Ribo Nucleic Acid contains OH group at second carbon where as Deoxyribo Nucleic Acid lacks OH group at Second carbon.....DNA is Double standed helix whereas RNA is single stranded

What are carbohydrates, Q. What are carbohydrates? Carbohydrates are i...

Q. What are carbohydrates? Carbohydrates are important organic compounds widely distributed in animals and plants. Plants can synthesize carbohydrates by the process of photos

After the blastula stage what is the next stage, Q. After the blastula stag...

Q. After the blastula stage what is the following stage of the embryonic development? What is the passage from blastula to the next stage called? The blastula turns into gastru

Hyperventilation and respiratory alkalosis, A 48-year-old male patient, who...

A 48-year-old male patient, who normally enjoys good health, has been admitted to the hospital for the treatment of polycythemia vera. The nurse who is providing care for the patie

Observation of bumpus, An interesting observation made by an American biolo...

An interesting observation made by an American biologist H.C. Bumpus (1899) provides a good explanation for normalising selection. Bumpus collected some 136 injured house sparrows

What is community ecology explain their characterstics, What is Community E...

What is Community Ecology explain their characterstics? Community Ecology: In ecological terms, a community consists of an assemblage of all of the populations living and int

What is juvenile mitral stenosis, Q. What is Juvenile Mitral Stenosis ? ...

Q. What is Juvenile Mitral Stenosis ? Peculiar to developing countries is the problem of juvenile mitral stenosis. Patients with rheumatic fever develop tight mitral stenosis i

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd