Nested brackets as a cladogram, Biology

Assignment Help:

using either nested brackets as a cladogram, what are the hierarchical relationships among the followingtaxa:raniates, amniotes, mammals, actinopterygians, chondrichthyes, aves, vertebrates, sharks, dinasours, and sarcoptertgians?


Related Discussions:- Nested brackets as a cladogram

State about bone physiology, State about Bone physiology Bone physiolog...

State about Bone physiology Bone physiology that is most relevant to the study of mechanically mediated bone adaptation and its relevance in implant dentistry. These aspects in

Radiographic imaging, R a d i o g raphic imaging: ...

R a d i o g raphic imaging: Radiology has been in use since the discovery of X-rays by Wilhelm Conrad Roentgen in 1895. Until 1980s, radiography was the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are stains - staining strategies, What are stains? Microorganisms ...

What are stains? Microorganisms are difficult to be seen in living state because of their minute, colourless and transparent nature. Moreover, there is limitation of insufficie

Explain trichomoniasis, Trichomoniasis  Oral metronidazole has been the...

Trichomoniasis  Oral metronidazole has been the treatment of choice for trichomoniasis. Tinidazole (Tindamax - Medical Letter 2004; 46:70), a nitroimidazole similar to metronid

Explain malnutrition, Explain Malnutrition Malnutrition, impaired immun...

Explain Malnutrition Malnutrition, impaired immunity and infection can form a triad or vicious cycle, as illustrated in Figure, which works synergistically and thus worsens the

Explain serum lipoprotiens, Explain Serum lipoprotiens Serum lipoprot...

Explain Serum lipoprotiens Serum lipoprotiens:- spherical  or  ellipsoidal  particles containing  proteins, cholesterol esters  and  triacylglycerols, encased  within  a mon

Progressive senescence - senescence, Progressive senescence - Senescence ...

Progressive senescence - Senescence This is the third category of senescence. Here also the leaves are shed but it is gradual senescence of leaves up the stem. For example, th

Cystitis, C y s t i t i s It is the inflammation of urinary blad...

C y s t i t i s It is the inflammation of urinary bladder characterized by frequent painful urination and presence of blood and cells in urine. E t iology:

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd