Mitral valve replacement -mitral valve disease, Biology

Assignment Help:

Mitral Valve Replacement :  Patients who require surgery and are not candidates for BMV, CMV or OMV should have mitral valve replacement (MVR).

561_Mitral Valve Replacement.png

Types of Surgery for Mitral Stenosis

The surgical procedures for mitral stenosis are:

1) Closed mitral valvotomy (CMV) also called closed mitral commissurotomy (CMC) .

2) Open mitral valvotomy (OMV).

3) Mitral valve replacement (MVR).

 


Related Discussions:- Mitral valve replacement -mitral valve disease

How many people carry the allele, Phenylketonuria is a severe form of menta...

Phenylketonuria is a severe form of mental disability caused by a homozygous recessive allele. The condition affects about 1 in 10,000 neborn Caucasians. Estimate the frequency of

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Direction does growth of one side of branch, To which direction does the gr...

To which direction does the growth of one side of branch, a stem or root induce the structure to curve? Whenever one side of a branch, stem or root grows more than the other si

Introduction to locomotion, LOCOMOTIO N - Displacement of body. Mos...

LOCOMOTIO N - Displacement of body. Mostly animals show locomotion except porifera, urochordata, corals, obelia thier larva may show locomotion. Its importance is -

Extracellular signals, extracellular signals and their characteristics

extracellular signals and their characteristics

What are instances of a carnivorous, Q What are instances of a carnivorous ...

Q What are instances of a carnivorous and an herbivorous reptile? Iguanas are herbivorous, Snakes are carnivorous. Q. Do beings of the class Reptilia perform gas exchange i

Tricuspid excision-types of surgery, Tricuspid Excision :  For tricus...

Tricuspid Excision :  For tricuspid valve endocarditis with vegetations in drug users, valve excision is done by removing three cusps and chordae and papillary muscles. Later

What is antimicrobial resistance, Question 1 What is antimicrobial resista...

Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani

Haversian canals and the volkmann canals of the bones, Q. What are the Have...

Q. What are the Haversian canals and the Volkmann's canals of the bones? Is the osseous tissue vascularized? The Haversian canals are longitudinal canals present in the osseous

Anaplasia - characteristics define cancer, Anaplasia - Characteristics Defi...

Anaplasia - Characteristics Define Cancer Anaplasia is a structural abnormality where cells resemble primitive or embryonic tissue in which adult functions are diminished or t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd