Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Mitral Valve Replacement : Patients who require surgery and are not candidates for BMV, CMV or OMV should have mitral valve replacement (MVR).
Types of Surgery for Mitral Stenosis
The surgical procedures for mitral stenosis are:
1) Closed mitral valvotomy (CMV) also called closed mitral commissurotomy (CMC) .
2) Open mitral valvotomy (OMV).
3) Mitral valve replacement (MVR).
Phenylketonuria is a severe form of mental disability caused by a homozygous recessive allele. The condition affects about 1 in 10,000 neborn Caucasians. Estimate the frequency of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
To which direction does the growth of one side of branch, a stem or root induce the structure to curve? Whenever one side of a branch, stem or root grows more than the other si
LOCOMOTIO N - Displacement of body. Mostly animals show locomotion except porifera, urochordata, corals, obelia thier larva may show locomotion. Its importance is -
extracellular signals and their characteristics
Q What are instances of a carnivorous and an herbivorous reptile? Iguanas are herbivorous, Snakes are carnivorous. Q. Do beings of the class Reptilia perform gas exchange i
Tricuspid Excision : For tricuspid valve endocarditis with vegetations in drug users, valve excision is done by removing three cusps and chordae and papillary muscles. Later
Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani
Q. What are the Haversian canals and the Volkmann's canals of the bones? Is the osseous tissue vascularized? The Haversian canals are longitudinal canals present in the osseous
Anaplasia - Characteristics Define Cancer Anaplasia is a structural abnormality where cells resemble primitive or embryonic tissue in which adult functions are diminished or t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd