Metaphase of karyokinesis, Biology

Assignment Help:

- Nuclear membrane disorganize at the beginning of this phase.

- Spindle fibers originate and the kinetochore fibers attach to the kinetochore of homologous chromosomes from each pole and arrange bivalents at the equator. The sister chromatids of individual chromosomes in bivalent behaves as a unit.


Related Discussions:- Metaphase of karyokinesis

Explain infants and preschool children, Explain Infants and Preschool Child...

Explain Infants and Preschool Children Growth? In this unit we will be studying about one of the crucial phases of human growth and development i.e. infancy to preschool years.

Explain an overview of water soluble vitamins, Explain An Overview of Wate...

Explain An Overview of Water Soluble Vitamins? Vitamins, we already know, are classified by the materials in which they will dissolve. Fat-soluble vitamins -vitamin A, D, E a

Define the flavonoids, Define the Flavonoids? Flavonoids constitute the...

Define the Flavonoids? Flavonoids constitute the largest group of plan1 polyphenols, generally arc the compounds of low molecular weight, bound to sugar molecules. You may be f

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

By which term liverworts and mosses are characterized, Liverworts and mosse...

Liverworts and mosses are characterized by their lack of vascular conducting tissue. These two groups of liverwort, plants and mosses, are known by which of the below terms: a)

Define x-ray chest and coronary angiography, Q. Define X-Ray Chest and Coro...

Q. Define X-Ray Chest and Coronary Angiography? X-Ray Chest It shows cardiomegaly with left ventricle (LV) and left atrium (LA) enlargement. There may be signs of pulmona

Define procedure for testing presence of proteins in milk, Define Procedure...

Define Procedure for Testing the Presence of Proteins in Milk? 1. Add 0.5 ml of alcohol to 0.5 ml milk.  Alcohol helps in curdling the milk. 2. Observe for the curdling of m

List the requirements of implant materials, List the requirements of implan...

List the requirements of implant materials. a) Biologically compatibility: an ideal implant material will elicit mainly physiological reactions within the surrounding tissues (

Diarrhoea, Diarrhoea   Diarrhoea refers to frequent passage of loose wa...

Diarrhoea   Diarrhoea refers to frequent passage of loose watery stools. Acute diarrhoea often called as acute gastroenteritis  is particularly a leading cause of mortality in

Explain some functions of riboflavin, Explain Some Functions of Riboflavin?...

Explain Some Functions of Riboflavin? Protective role: Riboflavin protects the octodermal tissues and prevents lesions  of the skin, eye and nervous system. Riboflavin amelior

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd