Meaning of cellular secretion, Biology

Assignment Help:

Cell secretion is the elimination to the exterior of substances formed by the cell (for example, hormones, mucous, sweat, etc.)

 


Related Discussions:- Meaning of cellular secretion

Reroduction, describe and compare reproduction in all the kingdoms except k...

describe and compare reproduction in all the kingdoms except kingdom animalia

Explain genetic information that is transmitted hereditarily, Which is the ...

Which is the biological molecule that contains the genetic information that is transmitted hereditarily and controls the cellular functioning? The hereditary molecule that cont

Most abundant form under which nitrogen is found in nature, Q. What is the ...

Q. What is the most abundant form under which nitrogen is found in nature? The major abundant nitrogen-containing molecule found in nature is molecular nitrogen (N2). The air i

Define about the composition of body weight, Define about the Composition o...

Define about the Composition of Body Weight? You might have read in previous units that our body weight is composed of muscle bone and fat. Segregating these components of body

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain reproducibility of venricular ectopy, Q. Explain Reproducibility of...

Q. Explain Reproducibility of Venricular Ectopy ? Experimentally it has been shown that PVCs are frequently seen at the inception of acute ischaemia. Thus, exercise induced PVC

What is difference between the beta and the alpha-protien, Q. What is the d...

Q. What is the difference between the beta-sheet and the alpha-helix protein conformations? Beta-sheet and Alpha-helix conformations are the two main types of secondary structu

Autoradiography, Autoradiography Autoradiography is a modification of t...

Autoradiography Autoradiography is a modification of the radioactive tracer technique. In this technique, the radioactivity is detected by a thin film of photographic emulsion

Give three examples of artificial selection, Give three examples of artific...

Give three examples of artificial selection. Include examples of both animals and plants.  Answers will vary, but could include domestic cats, domestic dogs, cattle, sheep, an

Determine by nutritive muscular cell?, Determine by nutritive muscular cell...

Determine by nutritive muscular cell? The cells which form the gastrodermis lining the inner cavity of cnidarians. They carry out two functions: First is to absorb and digest f

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd