Malignant catarrhal fever (mcf), Biology

Assignment Help:

Malignant catarrhal fever (MCF)


Malignant catarrhal fever is invariably fatal generalized lymphoproliferative disease of cattle and sometimes of wild ruminants. It is common in Africa, parts of Europe and in feedlot cattle in North America. The disease primarily affects lymphoid tissues and epithelial cells of respiratory and gastrointestinal tract. Sheep act as reservoir for MCF virus.


Epidemiology: The disease primarily affects adult cattle. Sheep act as carriers of the virus. The aetiological agent, a member of the sub-family Gammaherpesvirinae, is designated as Alcelaphine herpes virus-1. Cattle are believed to be infected via the relatively large amounts of virus present in the nasal secretions of wild beast calves. The virus is not transmitted between cattle, which appear to be dead end hosts.


Symptoms: The disease is characterized by high fever with copious discharge from the mouth, nose and eyes. Ulcers covered with necrotic tissue deposits are seen on the tongue, gums, inside of the cheek and certain other parts. Vesicles appear all over the body, and the face and head are swollen. Usually the animals die in about a week.


Diagnosis:
The disease is diagnosed by the absence of diarrhoea and the presence of copious discharges from the nose and eyes, and by absence of ulcers in the abomasum and intestines of dead animals, though it can create confusion with rinderpest. The virus can be isolated when washed peripheral blood leukocytes are inoculated in calf thyroid cells. Cell free inocula do not yield virus. The cytopathic changes require at least 3 days to appear and several passages in cell culture are often necessary. They are characterized by syncytia formation and by the presence of typical herpesvirus intranuclear inclusion bodies.Treatment, prevention and control: Symptomatic treatment helps in the natural process of recovery. At present, no effective vaccine is available for the prevention of the disease. Cattle serve as dead end hosts and susceptible animals pick up the infection from wild bovidae especially from nasal secretions of infected wild beast calves. Attempt to develop a vaccine have been unsuccessful so far.


Related Discussions:- Malignant catarrhal fever (mcf)

Venting of the heart in myocardial protection, Venting of the Heart :  It ...

Venting of the Heart :  It is important that heart does not distend during cardio pulmonary bypass. This is prevented by venting of the left side of the heart by inserting a cannu

#title., 15 character of protozoa

15 character of protozoa

Reproductive cycle - human development, Reproductive Cycle The whole r...

Reproductive Cycle The whole reproductive cycle consists of an ovarian cycle and a uterine cycle. Figure illustrates one complete reproductive cycle. You can observe in the fi

Transport in phloem, Transport in Phloem The basic necessities of plan...

Transport in Phloem The basic necessities of plants, water, are taken up by the roots. Another purpose served by the roots is to absorb water soluble mineral nutrients from th

What is the prevailing wind direction, what is the prevailing wind directio...

what is the prevailing wind direction in equatorial regions affected by the trade winds? a) The wind blows from east to west b) the wind blows from west to east

Emergency room management, Emergency Room Management Patient may needs...

Emergency Room Management Patient may needs incubation and ventilatory support till such time that patient is able to breathe normally. In some cases: patient is admini

Define light source of microscope, Define Light Source of Microscope? I...

Define Light Source of Microscope? It is either mirror or electric illuminator present at the base. Identify the mirror in Figure. Some microscopes have reversible mirror with

What is ridge morphology, What is Ridge morphology The implant-supporte...

What is Ridge morphology The implant-supported prosthesis is affected by the ridge morphology especially implant-supported overdentures which gain dual support from implants an

Which type of plant tissue is cork, Which type of plant tissue is cork? ...

Which type of plant tissue is cork? Cork, the material, for example, used to cap wine bottles, is extracted from the suber of a special oak known as cork oak.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd