Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Kangroo Rat
Kangroo rat Dipodornys merriami, a native of South-West America is a classical example of how small mammals survive in desert. It exhibits all the osmoregulatoryadaptations for desert life. It survives in arid conditions without ingesting any free water by the followi.ng adaptations:
Kangroo rat is not known to drink water. It gets only a trace of free water from the dry seeds it eats. Primarily it depends upon the metabolic water for its survival.
Q. Causes of Non-Ketotic Hyperosmolar Diabetic Coma? The causes of NKHDC are given below: 1) Infections 2) Trauma 3) Burns 4) Myocardial Infarctions (heart attack)
How can we determine the status of brain function Neuropsychological assessment is the clinical practise of using tests and other behavioural evaluation instruments to determin
Echocardiography is one of the -most frequently used imaging modalities for diagnosing cardiovascular diseases. It i's versatile and is applicable in the entire spectrum of
In the scientific competition against fixism what are the main arguments that favor evolutionism? The major arguments in favor of evolutionism are paleontological, from the stu
Q. Why does thermal inversion increases air pollution? What harm can thermal inversion cause to humans? The Thermal inversion confines at low altitude a layer of pollutants tha
Behaviour change communication is necessary as it ensures that the diabetic patient and their families have access to correct information about the disease, complications, treatm
What do you mean by Post-Herbal Period ? Ans. It is difficult to draw a sharp line of demarcation between the transition period, marked by various attempts of classificati
Food chain is the simplest representation of energy flow in the community. At the base is energy stored in the plants, which are eaten by the small organisms, which in turn are ea
2 phases of oogenesis
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd