Kangroo rat, Biology

Assignment Help:

Kangroo Rat

Kangroo rat Dipodornys merriami, a native of South-West America is a classical example of how small mammals survive in desert. It exhibits all the osmoregulatoryadaptations for desert life. It survives in arid conditions without ingesting any free water by the followi.ng adaptations:

  1. It avoids much of the daytime heat through nocturnal life-style, keeping cool, during daylight hours by remaining in a burrow. This conserves water loss through evaporative cooling.
  2. It conserves respiratory moisture by an efficient nasal countercurrent mechanism.
  3. It secretes highly concentrated urine.
  4. The rectum absorbs water from the faeces resulting in dry faecal pellets.

Kangroo rat is not known to drink water. It gets only a trace of free water from the dry seeds it eats. Primarily it depends upon the metabolic water for its survival.


Related Discussions:- Kangroo rat

Causes of non-ketotic hyperosmolar diabetic coma, Q. Causes of Non-Ketotic ...

Q. Causes of Non-Ketotic Hyperosmolar Diabetic Coma? The causes of NKHDC are given below: 1) Infections 2) Trauma 3) Burns 4) Myocardial Infarctions (heart attack)

How can we determine the status of brain function, How can we determine the...

How can we determine the status of brain function Neuropsychological assessment is the clinical practise of using tests and other behavioural evaluation instruments to determin

Basics of echocardiography, Echocardiography is one of the -most frequent...

Echocardiography is one of the -most frequently used imaging modalities for diagnosing cardiovascular diseases. It i's versatile and is applicable in the entire spectrum of

Fixism what are the main arguments that favor evolutionism, In the scientif...

In the scientific competition against fixism what are the main arguments that favor evolutionism? The major arguments in favor of evolutionism are paleontological, from the stu

Why does thermal inversion increases air pollution, Q. Why does thermal inv...

Q. Why does thermal inversion increases air pollution? What harm can thermal inversion cause to humans? The Thermal inversion confines at low altitude a layer of pollutants tha

Meaning of behaviour change communication, Behaviour change communication i...

Behaviour change communication is necessary as it ensures that the diabetic patient and their families have access to correct information about the disease, complications, treatm

What do you mean by post-herbal period, What do you mean by Post-Herbal Per...

What do you mean by Post-Herbal Period ? Ans. It is difficult to draw a sharp line of demarcation between the transition period, marked by various attempts of classificati

Food chain, Food chain is the simplest representation of energy flow in th...

Food chain is the simplest representation of energy flow in the community. At the base is energy stored in the plants, which are eaten by the small organisms, which in turn are ea

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd