Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Is nitrogen is important plant nutrients
Nitrogen is an important plant nutrient which is assimilated by most of the plants as nitrate and ammonium ions. Organic matter is the store house of all nitrogen in the soil. Regardless of the form of nitrogen absorbed by plants, it is reduced to the -N=, NH- , -NH2 forms and then forms more complex compounds and ultimately leads to formation of proteins. In addition, nitrogen is present in many biomolecules such as chlorophyll, nucleotides, phosphatides (phospholipids) and alkaloids, as well as many enzymes, hormones and vitamins. These biomolecules are of great physiological importance in metabolism
What are the new technologies need in biology?
feeding habit of branchiostoma?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is a vesicle? A vesicle is a relatively minute intracellular, membrane-enclosed sac that keeps or transports substances
Q. Define the Herbals? During the Middle Ages, following the decline of the Greek and Roman civilisations, little significant botanical progress was made. The early herbals (i.
How Water Balance Take Place in Human Body? The amount of fluid in the body is tightly controlled because imbalance can be devastating. In a normal individual, the maintenance
Define Feeding and Nutritional Management for Neuro trauma? The main objective of nutritional management is to counteract the hypermetabolism associated with inflammation. The
Explain The concentration of a solution The concentration of a solution is the amount of solute dissolved in a specified amount of solvent or solution. When the concentration
A healthy skeletal muscle fiber is isolated and has no external forces on it. It has normal intracellular levels of ATP and is bathed in physiological saline. Which of the follow
Minerals :- Magnesium Food Source Whole grains, nuts, legumes, green leafy vegetables Nutritional Functional role Essential nutrient: Deficiency is rare Co
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd