Is nitrogen is important plant nutrients, Biology

Assignment Help:

Is nitrogen is important plant nutrients

Nitrogen is an important plant nutrient which is assimilated by most of the plants as nitrate and ammonium ions. Organic matter is the store house of all nitrogen in the soil. Regardless of the form of nitrogen absorbed by plants, it is reduced to the  -N=, NH- , -NH2 forms and then forms more complex compounds and ultimately leads to formation of proteins. In addition, nitrogen is present in many biomolecules such as chlorophyll, nucleotides, phosphatides (phospholipids) and alkaloids, as well as many enzymes, hormones and vitamins. These biomolecules are of great physiological importance in metabolism

 


Related Discussions:- Is nitrogen is important plant nutrients

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is a vesicle, What is a vesicle? A vesicle is a relatively minute ...

What is a vesicle? A vesicle is a relatively minute intracellular, membrane-enclosed sac that keeps or transports substances

Define the herbals, Q. Define the Herbals? During the Middle Ages, foll...

Q. Define the Herbals? During the Middle Ages, following the decline of the Greek and Roman civilisations, little significant botanical progress was made. The early herbals (i.

How water balance take place in human body, How Water Balance Take Place in...

How Water Balance Take Place in Human Body? The amount of fluid in the body is tightly controlled because imbalance can be devastating. In a normal individual, the maintenance

Explain nutritional management for neuro trauma patients, Define Feeding an...

Define Feeding and Nutritional Management for Neuro trauma? The main objective of nutritional management is to counteract the hypermetabolism associated with inflammation. The

Explain the concentration of a solution, Explain The concentration of a sol...

Explain The concentration of a solution The concentration of a solution is the amount of solute dissolved in a specified amount of solvent or solution.  When the concentration

Discuss about sarcoplasmic reticulum, A healthy skeletal muscle fiber is is...

A healthy skeletal muscle fiber is isolated and has no external forces on it.  It has normal intracellular levels of ATP and is bathed in physiological saline.  Which of the follow

Explain the nutritional and functional role of magnesium, Minerals :- Magne...

Minerals :- Magnesium    Food Source      Whole grains, nuts, legumes, green leafy vegetables Nutritional Functional role Essential nutrient: Deficiency is rare Co

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd