Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Illustrate the Respiratory System
In general, respiration and breathing are understood to be same. But it is not so. Breathing simply means taking in oxygen from air and giving out carbon dioxide to air. Whereas respiration involves breathing in or inspiration, breathing out or expiration, exchange of carbon dioxide and oxygen in lung, transport of these gases in blood and ultimately, use of oxygen in the cells to convert digested food to energy. The last part of the respiration process is also known as cellular respiration
Variation exhibited in shared traits present in a population is due to alleles of the shared genes. can be influenced by interactions of alleles of multiple genes. Can be influence
Gelation Agar gels can be formed in very dilute solutions containing a fraction of 1% agar. In fact gelation is perceptible at concentrations as low as 0.04%. These gels are ri
green gland is excretory organ of which ortopodic phylem
The various organs involved in the digestion process are: Alimentary tract which includes mouth, pharynx, esophagus stomach, small intestine, large intestine, appendix, rec
What is the difference between osmosis and diffusion? Osmosis is the occurrence of movement of solvent particles (in general, water) from a region of lower solute concentration
Explain the Direct Microscopic Counts (DMC) The process includes making a smear of food sample on a microscope slide followed by staining with an appropriate dye and viewing an
Movement is even controlled by organelles, cilia and flagella. These and the pseudopodia in the amoebas give these small creatures movement, something we associate with animals. Es
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Microorganisms on basis of oxygen requirement for growth? On basis of oxygen requirement for growth: - Obligate Aerobes: Require oxygen for growth and multiplication e.g
What is the physiological cause of the syndrome known as cretinism? Cretinism is caused by chronic deficiency of the thyroid hormones (T3 and T4) during childhood. The chronic
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd