How much fat contain vegetable butters, Biology

Assignment Help:

Vegetable Butters

 Fats of this group are derived from the seeds of various tropical trees and are distinguished by their narrow melting range, which is due mainly to the arrangement of fatty acids in the triacylglycerol molecules. In spite of their large ratio of saturated to unsaturated fatty acids, trisaturated acylglycerol are not present. The vegetable butters are extensively used in the manufacture of confections, with  cocoa butter being the most important member of the group.

 


Related Discussions:- How much fat contain vegetable butters

What is the relationship between hypothesis and a theory, What is the relat...

What is the relationship between the following scientific terms: hypothesis, a theory, and a natural law?

Basic research terms - nursing research, Basic Research Terms: Some of...

Basic Research Terms: Some of the basic  terms that are defined  in  this section are:  Assumptions Operational Definitions  Variables  Delimitation and Limitation  H

Determine the mechanical properties of ti and ti alloy, Mechanical Properti...

Mechanical Properties of Ti and Ti Alloy as Compared to Bone  Titanium tends to seize when in sliding contact with itself or other metal. Titanium based alloys have a high co-e

Locomotion in mollusca, Locomotion in Mollusca The major locomotor or...

Locomotion in Mollusca The major locomotor organ in Mollusca is the foot, which is a characteristic feature of these animals. In its simplest form the foot is a flit ventral

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define proteins as biological buffers, Define Proteins as biological buffer...

Define Proteins as biological buffers? Proteins have the ability to accept or donate hydrogen ions and by doing so they serve as biological buffers. In blood, there are three i

Explain the role of lipoprotein, Explain the Role of Lipoprotein ? As d...

Explain the Role of Lipoprotein ? As discussed in the previous section, serum concentrations of Lp(a) are elevated in South Asians irrespective of their migrant status. Several

Prepare a dichotomous key, Prepare a dichotomous key the following organism...

Prepare a dichotomous key the following organisms, ant, butterfly, fly, beetle, grass hopper, wasp, ladybug, roach and dragonfly

Explain ledge bypass - non-surgical endodontic retreatment, Explain Ledge b...

Explain Ledge bypass - Non-surgical Endodontic Retreatment   Ledge bypass - StSt not NiT cause it has shape memory Ledges from outside the curvatures. The file t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd