How is cancer usually treated, Biology

Assignment Help:

Q. How is cancer usually treated?

If the cancer is in its initial stage cure is often done by surgical removal of the neoplastic tissue. The Cancers already disseminated are often treated with radiation (radiotherapy) and anti-mitotic drugs (chemotherapy).


Related Discussions:- How is cancer usually treated

Fatty acids, F A TT Y ACIDS They are monocarboxylic organic acids...

F A TT Y ACIDS They are monocarboxylic organic acids (R.COOH) having a hydrocarbon chain of 4 - 30 carbon atoms. The polar carboxylic group is hydrophilic (Gk. hydro

Define classification of carbohydrates - oligosaccharides, Define classific...

Define classification of carbohydrates - Oligosaccharides? Oligosaccharides are short chains of saccharide units and are condensation products of three to ten monosaccharides.

Female reproductive disorders-dystocia, Dystocia Dystocia or difficult...

Dystocia Dystocia or difficult calving is a condition where help is required as providing traction, repositioning of fetus, foetotomy or caesarotomy. Generally, ease of calvin

Triploblastic, What Is the advantage of having a coelomic body cavity

What Is the advantage of having a coelomic body cavity

Pericardium, The heart is enclosed in a membranous sac called the pericardi...

The heart is enclosed in a membranous sac called the pericardium. It has two layers- the fibrous pericardium which is the outer layer and the serous pericardium that lies inside th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Development assistance for healthcare, Normal 0 false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Human reproduction, what stimulate pituitary to release the hormone respons...

what stimulate pituitary to release the hormone responsible for paturation name the hormone

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd