How is cancer usually treated, Biology

Assignment Help:

Q. How is cancer usually treated?

If the cancer is in its initial stage cure is often done by surgical removal of the neoplastic tissue. The Cancers already disseminated are often treated with radiation (radiotherapy) and anti-mitotic drugs (chemotherapy).


Related Discussions:- How is cancer usually treated

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define about the classification of polyphenols, Define about the Classifica...

Define about the Classification of polyphenols?  The various classes are: a) Phenolic acids and derivatives b) Flavonoids such as Flavonols and Flavones, Isoflavones and

Proteins requirements for ulcerative colitis, Q. Proteins requirements for ...

Q. Proteins requirements for ulcerative colitis? Proteins: Patients with ulcerative colitis lose about 4-8 g fecal N2 as compared to the normal excretion of 2 g. In severe ulce

Failure of public production, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Define surgical procedures for cancer patient, Define Surgical Procedures f...

Define Surgical Procedures for Cancer Patient Major resection of the small bowel is not common. Resection of the ileum leads to certain physiological and nutritional problems.

How lead to over expression of the protein, You have discovered that a sing...

You have discovered that a single protein in two different cell lines is significantly over expressed in one of them. The proteins are identical, yet Northern blot analysis has dem

What is the tree girdling, What is the tree girdling? What happens to the p...

What is the tree girdling? What happens to the plant when that girdle is removed from the stem (below the branches)? Tree girdling or Malpighi's girdling is the removal from a

Metabolic processes, Metabolic Processes Living things are complex...

Metabolic Processes Living things are complex and yet, the cell is the basic unit of life New cells result of mitosis cell division DNA controls all cell functions

Define the density of egg, Define the density of egg  The density of e...

Define the density of egg  The density of egg products is not affected by dehydration. When a dried egg product is reconstituted to its natural solids, it has about the same d

The similarities and differences of transposable elements, Discuss the simi...

Discuss the similarities and differences of transposable elements in E. coli, yeast, plants, and Drosophila.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd