How can you convert 147.05mg%, Biology

Assignment Help:

How do you convert 147.05mg% of plasma glucose to mM/L please show work.


Related Discussions:- How can you convert 147.05mg%

Explain about monocot plants and dicot plants, What are the major morpholog...

What are the major morphological differences between monocot plants and dicot plants? The main differentiation criteria among monocots and dicots are: number of cotyledons (see

The cardiac cycle during which the ventricles are filled, What is the stage...

What is the stage of the cardiac cycle during which the ventricles are filled? The filling of the ventricles with blood happens during diastole. The Circulatory System - Ima

Which harmone is not associated with male reproduction, Which of the below ...

Which of the below is NOT hormone associated with male reproductive physiology: a) Prolactin b) Testosterone c) Interstitial hormone d) Follicle-stimulating hormone

Pectin, PECTIN It consists of methylated galacturonic acid, galactos...

PECTIN It consists of methylated galacturonic acid, galactose & arabinose. It is also called plant cement becuase it binds layers of cell wall. It is a structural poly

Why immune mechanism of body of a patient gets suppressed, Name the disorde...

Name the disorder in which the immune mechanism of the body of a patient gets suppressed. Which pathogen is responsible for it? Give any two reasons of its transmission.

Cell theory, why is virus an exception of cell theory

why is virus an exception of cell theory

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Fats requirement in diabetes, Q. Fats requirement in diabetes? Fats: Th...

Q. Fats requirement in diabetes? Fats: The total fat recommended by WHO is less than 30% of the total calories. However in view of the widely prevalent Asian paradox in India,

How can asexual reproduction in planarias be described, How can asexual rep...

How can asexual reproduction in planarias be described? Planarias can separate themselves asexually by transversal bipartition because of the great regeneration capability of t

Adverse effects of air pollution, Air pollution affects both living and non...

Air pollution affects both living and non-living matter. The effects can be classified as.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd