Hemicryptophytes - classes of life form, Biology

Assignment Help:

Hemicryptophytes - Classes of Life Form

In this case the perennating buds or organs are situated at the soil surface where they are protected by soil and fallen leaves. These include herbs growing in rosettes and tussocks. These plants are found in cold, temperate zones, where aerial parts die at the onset of unfavourable conditions. Most of the biennial and perennial herbs come under this category.


Related Discussions:- Hemicryptophytes - classes of life form

What is the function of the skin in humans, Q What is the function of the s...

Q What is the function of the skin in humans? The skin is the external covering of the body. In humans its major functions are protection and perception of information from the

Field capacity (fc), Field Capacity (FC) It is the capacity of a field...

Field Capacity (FC) It is the capacity of a field to hold the amount of water against gravitational forces. It is expressed as the percentage of the dry weight of the soil. Fi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Animals of the littoral zone, Animals of the littoral zone Animals of...

Animals of the littoral zone Animals of this zone may be herbivores, carnivores or detritus feeders and are as diverse as plants. Many of them such as rotifers, protozoans, i

How do you define normal pulmonary vasculature, Q. How do you define Normal...

Q. How do you define Normal Pulmonary Vasculature? Pulmonary vessels are seen in the medial 2/3 of the lung. Vessels are generally not identified in the lateral third. The rad

Parathyroid disorders, PARATHYROID DISORDERS - (i) Hypoparathyroidism ...

PARATHYROID DISORDERS - (i) Hypoparathyroidism (deficiency of PTH) . It causes the lowering of blood calcium level. This increases the excitability of nerves and muscles, caus

Muscles, what process provides the energy for muscle contraction?

what process provides the energy for muscle contraction?

Simple tips to diarrhoea patient, A few simple tips which should be given t...

A few simple tips which should be given to the patient. • Boiling, steaming, baking, pressure cooking should be encouraged • Consume small and light meals frequently instea

Bovine viral diarrhoea, Bovine viral diarrhoea Bovine viral diarrhoea ...

Bovine viral diarrhoea Bovine viral diarrhoea (BVD) and mucosal disease (MD) are clinically dissimilar disease syndrome yet have a common viral etiology. The acute disease is

Explain the life cycle of nitrogen, Explain the life cycle of Nitrogen ? ...

Explain the life cycle of Nitrogen ? Nitrogen cycle: Along with carbon, hydrogen, and oxygen, nitrogen is one of the most common elements that form biological molecules. Nitr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd