Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Hemicryptophytes - Classes of Life Form
In this case the perennating buds or organs are situated at the soil surface where they are protected by soil and fallen leaves. These include herbs growing in rosettes and tussocks. These plants are found in cold, temperate zones, where aerial parts die at the onset of unfavourable conditions. Most of the biennial and perennial herbs come under this category.
Q What is the function of the skin in humans? The skin is the external covering of the body. In humans its major functions are protection and perception of information from the
Field Capacity (FC) It is the capacity of a field to hold the amount of water against gravitational forces. It is expressed as the percentage of the dry weight of the soil. Fi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Animals of the littoral zone Animals of this zone may be herbivores, carnivores or detritus feeders and are as diverse as plants. Many of them such as rotifers, protozoans, i
Q. How do you define Normal Pulmonary Vasculature? Pulmonary vessels are seen in the medial 2/3 of the lung. Vessels are generally not identified in the lateral third. The rad
PARATHYROID DISORDERS - (i) Hypoparathyroidism (deficiency of PTH) . It causes the lowering of blood calcium level. This increases the excitability of nerves and muscles, caus
what process provides the energy for muscle contraction?
A few simple tips which should be given to the patient. • Boiling, steaming, baking, pressure cooking should be encouraged • Consume small and light meals frequently instea
Bovine viral diarrhoea Bovine viral diarrhoea (BVD) and mucosal disease (MD) are clinically dissimilar disease syndrome yet have a common viral etiology. The acute disease is
Explain the life cycle of Nitrogen ? Nitrogen cycle: Along with carbon, hydrogen, and oxygen, nitrogen is one of the most common elements that form biological molecules. Nitr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd