Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Vaccines: In US, foods such as potatoes, tomatoes and bananas that can carry vaccine for the infectious liver disease - Hepatitis B, have been successfully produced on a small scale. Feasibility studies are being conducted to investigate whether these modified crops would help to deliver the vaccines to people living in developing countries. If the positive outcomes are indicated in these studies, it would help to save lives of many millions.
Protection of Plants against Toxic Substances Plants produce several toxic substances themselves and may also encounter the ones produced by other plants or present in the env
What is Anatomic concavities Anatomic concavities present in the lingual surface of the mandible, the sublingual fossa anteriorly and the submandibular fossa posteriorly. Norm
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta act
Q. What are the mechanisms of hemorrhage contention called? The physiological mechanisms of hemorrhage contention one of them is blood clotting are generically named hemostatic
A person with a cough takes a patent cough syrup. In three days, the cough is better. Does this mean that the syrup has cured the cough? Justify your answer. There is insuffic
What is Binary Fission in cell reproduction? Cell division takes place in prokaryotic cells by binary fission, also called prokaryotic fission. In prokaryotes, DNA is contained
Applications in Horticulture and Agriculture While going round in public parks, you might have observed plants trimmed in such a way giving appearances of animals like camel,
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Gene repressor proteins which inhibit the transcription of particular genes in eukaryotes also exist. They may act by binding either to control parts within the promoter region nea
What do biomass pyramids represent? Biomass pyramids show the sum of the masses of the individuals that participate in each trophic level of a food chain.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd