Female reproductive tract, Biology

Assignment Help:

Female Reproductive Tract

The female reproductive tract involves the fallopian tubes, uterus and vagina. Look at diagram. You would notice that the ovaries lay one on each side of the pelvic cavity. The fallopian tubes expand from the uterus and are not attached to the ovaries but have fingerlike projections called fimbria that sweep over the ovaries. Throughout the lime of ovulation, while the oocyte is released from the ovary it is generally swept into the fallopian tubes by the action of the fimbria and beating of the cilia that line the tubes.

602_Female Reproductive Tract.png

Figure - Female reproductive tract 40% with the ovarles

The wall of the uterus is comparatively thick and consists of three layers-the endometrium, myometrium and perimetrium. The endometrium makes the inner mucosal layer lining the uteri.ne cavity. This lining is covered along with columnar epithelium and contains numerous glands. The myometrium is thick and muscular. The perimetrium contains the outermost thin layer covering the body of the uterus. Out of the three layers of the uterus only the endometrium participates in the formation of the placenta. In a non-pregnant female the endometrium varies in its thickness as per to the monthly reproductive cycle or the menstrual cycle. The term menstrual cycle as you know refers particularly to changes in the uterus. During the monthly reproductive cycle in non-pregnant females just only the functional layer of the endometrium undergoes cyclic changes and varies in thickness.


Related Discussions:- Female reproductive tract

Effects on health - water pollution, Effects on Health - Water Pollution ...

Effects on Health - Water Pollution Water pollution deteriorates the quality of water used for drinking, bathing, swimming, recreation and irrigation. Water contaminated with

Heart in amphibians, Amphibia n - 3 chambered heart 2 auricles and ...

Amphibia n - 3 chambered heart 2 auricles and 1 ventricle. Sinus venosus and truncus arteriosus (its main part is pylengium) present. Incomplete double circulation prese

Describe u - waves, Q. Describe U - Waves? The U-wave is usually uprigh...

Q. Describe U - Waves? The U-wave is usually upright if the T is also upright and is highest at low rates. When the heart rate increases to more than 90, the U-wave is rarely v

Explain the sources of microorganisms, Explain the Sources of Microorganism...

Explain the Sources of Microorganisms? Microorganisms are virtually present everywhere in nature including air, water and soil. The microbial flora is also associated with the

What is a chromosomal translocation, Question 1 Write a short note on the ...

Question 1 Write a short note on the following- Plasmids Retrotransposons Hfr Conjugation Generalized transduction Question 2 With the help of a neat diagra

Define requirements of fat in postoperative nutritional care, Define Requir...

Define Requirements of Fat in Postoperative Nutritional Care Adequate amount of fat is needed to build up and maintain tissue fat reserves. Depending upon the existing health a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Energy, what are the types of pyramids studied

what are the types of pyramids studied

Define about the photometry - colorimetry, Define about the Photometry - co...

Define about the Photometry - colorimetry? Photometry is the measurement of the luminous intensity light or the amount of luminous light falling on a surface from such a source

What kind of structure is the crystalline lens, Q. What kind of structure i...

Q. What kind of structure is the crystalline lens? What is its function? The crystalline is a converging spherical lens this natural lens has the function to project images of

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd